معلومة

التنميط الجيني SNP باستخدام PCR

التنميط الجيني SNP باستخدام PCR


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

قرأت مقال ويكيبيديا هذا عن التنميط الجيني SNP ولم أتمكن من فهم هذا الجزء:

عند فحص النتائج ، إذا كانت العينة الجينومية متماثلة اللواقح ، فإن منتجات تفاعل البوليميراز المتسلسل الناتجة ستكون من البادئة التي تطابق موقع SNP مع الخيط الخارجي المعاكس التمهيدي أيضًا من البادرين الخارجيين المعاكسين. إذا كانت العينة الجينومية متغايرة الزيجوت ، فإن المنتجات ستنتج من أساس كل أليل إلى نظائرها من البادئات الخارجية وكذلك من البادئين الخارجيين المعاكسين.

يمكن لأي شخص أن يشرح هذا؟


XHTML صالح http://nar.oxfordjournals.org/content/29/17/e88/F1.large.jpg">http://nar.oxfordjournals.org/content/29/17/e88/F1.expansion)


الكشف عن متغيرات SARS-CoV-2 مع التنميط الجيني SNP

¶ https://www.cogconsortium.uk. تتوفر قائمة كاملة بأسماء الكونسورتيوم والشركات التابعة لها في ملف S1.

تصور الأدوار ، اكتساب التمويل ، التحقيق ، المنهجية ، الإشراف ، الكتابة - المراجعة والتحرير

مدرسة الانتساب للعلوم البيولوجية ، جامعة بريستول ، بريستول ، المملكة المتحدة

تصور الأدوار ، تنظيم البيانات ، التحليل الرسمي ، اكتساب التمويل ، التحقيق ، المنهجية ، الموارد ، البرمجيات ، الإشراف ، الكتابة - المسودة الأصلية ، الكتابة - المراجعة والتحرير

مدرسة الانتساب للعلوم البيولوجية ، جامعة بريستول ، بريستول ، المملكة المتحدة


كشف SNP

هناك العديد من الطرق لاكتشاف النيوكلوتايد الجديد والمعروف. وتشمل هذه تسلسل الحمض النووي ، وقياس الطيف الكتلي ، والمنارات الجزيئية ، ومصفوفات SNP الدقيقة ، والطرق القائمة على تفاعل البوليميراز المتسلسل.

يمكن تقسيم اكتشاف SNP إلى مجموعتين فرعيتين: اكتشاف SNP وفحص SNP. يتضمن اكتشاف SNPs SNPs التي لم يتم التعرف عليها بعد. يبحث الباحثون عن تعدد الأشكال الجديد في النيوكلوتايد في المناطق المستهدفة وعلى نطاق الجينوم. يتعلق فحص SNPs المعروفة باسم SNPs ، وعادة ما يبحث الباحثون عن النمط الجيني للأفراد أو تحديد ما إذا كان هناك SNP معين متورط في إنتاج خاصية معينة. هناك العديد من الطرق لإجراء كل من الاكتشاف والفحص. للحصول على حساب تاريخي ، راجع مقالة Kwok and Chen (1).


المواد والأساليب

تحضير الحمض النووي الجينومي

تم عزل الحمض النووي الجينومي من الدم الطازج باستخدام Wizard Genomic DNA PuriWcation Kit (Promega Corp. ، Madison ، WI) وفقًا لبروتوكول الشركة المصنعة. لفترة وجيزة ، تم نقل 300 ميكرولتر من الدم الكامل إلى الأنبوب الذي يحتوي على 900 ميكرولتر من محلول تحلل الخلية لتحليل خلايا الدم الحمراء. ثم بعد الطرد المركزي ، تم جمع الحبيبات البيضاء المرئية وتحللها بـ 100 ميكرولتر من محلول Nuclei Lysis. تم طرد العينة مرة أخرى وتم نقل المادة الطافية إلى أنبوب طرد مركزي نظيف سعة 1.5 مل يحتوي على 300 ميكرولتر من الأيزوبروبانول. يمكن أن تشكل خيوط الحمض النووي التي تشبه الخيوط البيضاء كتلة مرئية عن طريق خلط المحلول برفق. ثم تم غسل الحمض النووي الجينومي مرتين باستخدام 70 ٪ من الإيثانول وأخيراً تمت إعادة ترطيبه في 50 ميكرولتر من محلول معالجة الحمض النووي. تم تحديد جودة وكمية الحمض النووي بواسطة الرحلان الكهربائي للهلام وباستخدام NANODROP 1000 (Thermo Scientific ، Rockford ، IL).

تصميم PCR التمهيدي

تمت دعوة الطلاب لاسترداد قاعدة بيانات الجينات من National Center Biotechnology Institute وتصميم البادئات باستخدام برنامج Primer Premier 5. من خلال البحث عن مصطلح "human prdx6" في قاعدة بيانات الجينات ، يمكن للطلاب بسهولة العثور على السجل (http: // www.ncbi.nlm.nih.gov/gene/9588). من خلال النقر على "SNP" في هذه الصفحة ، يمكن للطلاب عرض جميع أشكال SNP لهذا الجين. ثم طُلب منهم معرفة أي SNP يمكن أن يشكل موقع تقييد بناءً على تسلسله المحيط. بعد تحليل جميع SNPs في قاعدة البيانات ، تم تحديد SNP واحد (rs4382766) ، لأنه تم العثور على موقع تقييد SspI يمتد عبر موقع SNP هذا. تم إدخال تسلسل يتكون من 500 نقطة أساس في المنبع والمصب من SNP هذا للبحث عن البادئات. تضمنت معلمات البحث طول التمهيدي ومنطقة البحث وطول المنتج. أخيرًا ، تم اختيار مجموعة من البادئات لـ PCR ، مع التمهيدي الأمامي CCAAACTACTCTTCTTTCCCAACT ، والتمهيدي العكسي GACACTGTGCCAGGCCATAC. كان الطول الكامل لمنتج PCR 449 نقطة أساس ، والذي سيتم تقسيمه إلى 186 و 263 نقطة أساس بعد هضم SspI للأليل T.

تضخيم جين Prdx6 بواسطة PCR

تم تضخيم جزء الحمض النووي المحدد الذي يمتد rs4382766 باستخدام PCR العادي ، والذي تم إجراؤه بحجم إجمالي قدره 20 ميكرولتر يحتوي على 0.5 ميكروغرام من الحمض النووي الجيني ، و 1.0 ميكرولتر من كل تمهيدي و 10 ميكرولتر من 2 × خليط رئيسي (تيانجين ، الصين). كانت معلمات تدوير PCR 94 درجة مئوية لمدة 5 دقائق ، تليها 35 دورة من 94 درجة مئوية لمدة 30 ثانية ، و 58 درجة مئوية لمدة دقيقة واحدة ، و 72 درجة مئوية لمدة دقيقة واحدة ، وامتداد إضافي واحد عند 72 درجة مئوية لمدة 5 دقائق . بعد ذلك ، تم تحليل 5 ميكرولتر من منتج PCR على هلام agarose 2٪.

تنقية منتج PCR

تمت تنقية منتج PCR الخام باستخدام SanPrep PCR Purification Kit (Sangon Co. Shanghai ، الصين). بعد إضافة ثلاثة أحجام من Buffer B3 إلى المنتج الخام ، تم قلب الأنبوب عدة مرات. ثم تم تحميل الخليط على مركز عمود ربط داخل أنبوب غسيل. بعد الطرد المركزي لمدة دقيقة واحدة ، تم غسل عمود التجليد مرتين باستخدام Wash Buffer. أخيرًا ، تمت إضافة 25 ميكرولتر من Elution Buffer إلى مركز العمود ، وتم طرده من أجل إزالة الحمض النووي المنقى.

إنزيم تقييد الهضم

بعد التحقق من منتج PCR عن طريق الرحلان الكهربائي ، تم هضم منتج PCR المنقى باستخدام إنزيم SspI (New England Biolabs Inc.) ، بحجم إجمالي 20 ميكرولتر يحتوي على 2 ميكرولتر 10 × عازلة ، 17 ميكرولتر من المنتج و 1 ميكرولتر (10U) ) من SspI. لتجنب الهضم غير الكامل ، تم تحضين الخليط عند 37 درجة مئوية لمدة ساعتين ، ثم تم تحليله على هلام الاغاروز بنسبة 2٪.

الاحتياطات والسلامة

للاحتياط وتوفير الوقت ، تم توفير معظم الكواشف / الحلول باستخدام المجموعات التجارية أو أعدها المعلم على دفعات قبل التجربة. كانت المادة الخطرة الرئيسية هي عينات الدم. على الرغم من أن هذه العينات مأخوذة من مواد صحية ، فقد تم إبلاغ الطلاب بالمخاطر وطُلب منهم اتباع إرشادات قواعد السلامة. كما تم إبلاغهم بالمواد الكيميائية الخطرة الأخرى المستخدمة في جميع التجارب ، وطُلب منهم ارتداء القفازات أثناء جميع الإجراءات. لضمان استمرار هذه الدورة المعملية ، تم إعداد الحمض النووي الجيني ومنتجات PCR من قبل المدرب لأولئك الذين فشلوا في الحصول على أي منتج لضمان وصول جميع الطلاب إلى الخطوة النهائية.


التسلسل

تقنيات التسلسل من الجيل التالي مثل التسلسل الحراري الأقل من 250 قاعدة في القراءة مما يحد من قدرتها على تسلسل الجينوم الكامل. ومع ذلك ، فإن قدرتها على تحقيق نتائج في الوقت الفعلي وإمكانية توسيع نطاقها بشكل كبير يجعلها خيارًا قابلاً للتطبيق لتسلسل المناطق الصغيرة لأداء التنميط الجيني SNP. بالمقارنة مع طرق التنميط الجيني SNP الأخرى ، فإن التسلسل مناسب بشكل خاص لتحديد تعدد الأشكال في منطقة صغيرة ، مثل منطقة مجمع التوافق النسيجي الرئيسي متعدد الأشكال في الجينوم.


التنميط الجيني - qPCR


يشير التنميط الجيني إلى عملية تحديد الاختلافات الجينية بين الأفراد في مجموعة سكانية. تعد الأشكال المتعددة للنيوكليوتيدات المفردة (SNPs) هي النوع الأكثر شيوعًا من التنوعات الجينية وبحسب التعريف هي الاختلافات أحادية القاعدة في موضع معين يوجد في أكثر من 1 ٪ من السكان. يمكن العثور على تعدد الأشكال في كل من مناطق الجينوم المشفرة وغير المشفرة ويمكن أن تؤدي إلى اختلافات نمطية عند العثور عليها في مناطق الترميز. يمكن أن تمنح تغييرات النمط الجيني نتائج نمطية إيجابية أو سلبية ، مثل تحمل الإجهاد الأكثر قوة في المحاصيل أو تعزيز القابلية للإصابة بالأمراض لدى البشر. وبالتالي ، غالبًا ما تكون SNPs علامات مفيدة لفهم بيولوجيا الكائنات الحية.

عند العثور عليها في المناطق غير المشفرة ، تعمل SNPs كعلامات لدراسات الجينوميات التطورية. ذات الصلة بـ SNPs هي & ldquoInDels & rdquo ، اختصار لـ فيsertions و ديلآفات النيوكليوتيدات متفاوتة الطول. كما هو الحال مع SNPs ، يمكن لـ InDels في مناطق الترميز تغيير تسلسل الأحماض الأمينية للبروتين ، إما عن طريق إضافة أو طرح حمض أميني إلى التسلسل إذا كان indel في مضاعفات 3 ، أو عن طريق إنشاء طفرة تغيير الإطارات إذا لم يكن indel في من مضاعفات العدد 3.

النوع الثالث من الاختلاف الجيني هو اختلاف عدد النسخ (CNV) ، والذي ينتج عن وجود أعداد مختلفة من نسخ جزء من الحمض النووي في جينومات مختلفة. في الحالات التي يكون فيها تباين رقم النسخ لجين مشفر ، يمكن أن يؤدي الاختلاف إلى القابلية أو المقاومة للمرض. بعض الأنماط الظاهرية أيضًا حساسة للجرعة ، ورقم النسخ مسؤول عن ظلال التباين بين أعضاء النوع.

لكل من التنميط الجيني SNP ، توجد العديد من الطرق لتحديد التركيب الجيني بين الأفراد. تعتمد الطريقة المختارة بشكل عام على احتياجات الإنتاجية ، وهي دالة لكل من عدد الأفراد الذين يتم تنميطهم الجيني وعدد الأنماط الجينية التي يتم اختبارها لكل فرد. تعتمد الطريقة المختارة أيضًا على كمية مادة العينة المتاحة من كل فرد أو عينة ، والتي تملي الحساسية المطلوبة للمقايسة.


هشاشة العظام: الدراسات الجينية للأشكال أحادية الجين والمعقدة

3.2.2 دراسات الارتباط على مستوى الجينوم

مع التقدم في تقنية التنميط الجيني SNP عالي الإنتاجية ، أصبحت دراسات الارتباط على مستوى الجينوم (GWAS) ممكنة في العقد الماضي. استفاد 17 GWAS من عدم توازن الارتباط (LD) ، أي حقيقة أنه في أي منطقة كروموسومية معينة في أليلات الجينوم في المواقع القريبة فعليًا ، يتم الفصل معًا في السكان. لا يلزم أن تكون العلامات التي تم تحليلها وظيفية ، ولكنها قد تكون ببساطة في صعوبة التعلم مع المتغير الوظيفي. 65 ومع ذلك ، فإن الطبيعة الواسعة النطاق لـ GWAS تقدم مشكلة اختبار متعددة تتطلب تكرار أي ارتباطات إيجابية. ومع ذلك ، فإن GWAS هي نهج قوي لفتح الأساس الجيني للأمراض المعقدة ، مثل الزراعة العضوية. قد يتم إعاقة الدراسات الفردية بسبب قيود حجم العينة ، مما يؤدي إلى نقص القوة الإحصائية وقد تساعد التحليلات الوصفية القائمة على جهود الاتحاد في التغلب على بعض هذه القيود.

تم نشر العديد من GWAS في الزراعة العضوية حتى الآن ويرد ملخص النتائج في الجدول 24.2. في حين أنهم يظهرون بوضوح أنه لا يوجد أليل محدد وشائع للغاية يسبب الزراعة العضوية ، فقد ظهرت بعض الجينات المثيرة للاهتمام. تحدد النتائج بشكل أفضل أنواع الجينات والمتغيرات الجينية التي تشارك في الزراعة العضوية وتوفر نظرة ثاقبة للبحث في المستقبل.

تم نشر أول GWAS باستخدام أكثر من 100000 علامة ، من المملكة المتحدة ، باستخدام الحمض النووي المجمّع من 357 مريضًا بالركبة و 285 عنصر تحكم. 66 حددت إشارة (rs4140564) بين PTGS2 و PLA2G4A. 66 تم نشر GWAS الثاني من الزراعة العضوية في الركبة ، من قبل مجموعة يابانية. 54 بعد فحص المرضى و 658 عنصر تحكم لـ 80.000 SNPs ، تم اختبار مجموعة فرعية من 2153 SNPs في مجموعة ثانية من 646 حالة OA في الركبة و 631 عنصر تحكم. تم تحديد متغيرين ، في هذه المنطقة على أنهما الأكثر ارتباطًا بقوة. تم تسمية الموضع بمضاعفة عامل فون ويلبراند أ (DWVA) ، واثنين من متغيرات الترميز ، rs11718863 و rs7639618 ، تم تأكيد ارتباطهما بقوة بخطر الإصابة بالتهاب الركبة ، بالإضافة إلى الحالات الصينية واليابانية وعينات التحكم. تم العثور على اثنين من SNPs للتأثير على ربط DVWA البروتين إلى-tubulin ، وافترض المؤلفون أن التوبولين والأنابيب الدقيقة قد تكون عوامل وقائية في التسبب في التهاب المفاصل. 54 في وقت لاحق ، ومع ذلك ، تم العثور على اثنين من SNPs لا تظهر أي ارتباط في الركبة أو الورك OA في مرضى القوقاز. 67 من ناحية أخرى ، تم عرض ذلك لاحقًا بشكل بيولوجي DVWA هو جزء من ترميز الجينات البشرية لسلسلة الكولاجين VI alpha4 (COL6A4) 68 (الجدول 24.2).

حددت دراسة يابانية أخرى اثنين من تعدد الأشكال داخل منطقة صغيرة من موضع HLA على الكروموسوم 6p ليكون مرتبطًا بالركبة OA ، مع ص & lt 7 × 10 −8. 56 ومع ذلك ، لم يتحقق التكرار في الأفواج الأوروبية وسكان الهان الصينيين. 69،70

حددت GWAS في الأفواج الأوروبية من هولندا (دراسة روتردام) إشارة (ص & lt 8 × 10 −8 ، أو 1.14) في منطقة على الكروموسوم 7q22 التي تضمنت كتلة LD كبيرة تمتد أكثر من 500 كيلو بايت مرتبطة بالركبة واليد OA. أدت إضافة عدة مجموعات أخرى إلى الدراسة الأصلية إلى زيادة مصداقية هذه الإشارة. ومع ذلك ، احتوت كتلة LD على ستة جينات معروفة ، وكلها مرشحة جيدة بنفس القدر للارتباط مع الزراعة العضوية. وتشمل هذه PRKAR2B (ترميز النوع التنظيمي المعتمد على البروتين كيناز - cAMP II-) ، جي بي آر 22 (ترميز مستقبلات البروتين G 22) ، و COG5 (مكون ترميز مركب جولجي قليل القسيمات 5). أظهر التحليل التلوي اللاحق ، الذي شمل 6709 مريضًا مصابًا بالتهاب المفاصل في الركبة و 44439 عنصر تحكم ، بشكل قاطع أن هذه الإشارة مرتبطة بأهمية الجينوم في العينات ذات الأصل الأوروبي مع OR = 1.17 (95٪ CI 1.11–1.24) ، و a ص- قيمة 9.2 × 10 9 ، ولكن ليس في السكان الآسيويين ، حيث كان OR 1.03 (95٪ CI 0.85-1.25 n.s.) 58 (الجدول 24.2).

دراسة arcOGEN عبارة عن كونسورتيوم بريطاني ، يقوم حول سبعة مراكز تجميع ، والتي أبلغت عن مجموعة اكتشاف مكونة من 3177 مريضًا و 4894 من السكان (ليسوا مميزين بشكل ظاهري). تضمن النسخ المتماثل للإشارات مجموعات أوروبية إضافية ، بالإضافة إلى أمريكا الشمالية القوقازية ، مما أدى إلى عينة شاملة من التحليل التلوي لـ13768 مريضًا في الورك والركبة و 53286 عنصر تحكم. على الرغم من أنها تضمنت أكبر حجم للعينة حتى الآن ، إلا أنها لم تتمكن من تحديد إشارة ذات أهمية على مستوى الجينوم. أقوى إشارة كانت rs2277831 (ص = 2.3 × 10 −5) ، تقع داخل ميكال 3. 72

في وقت لاحق ، أنتجت المجموعة نفسها 1000 احتساب قائم على مشروع جينوم 73 على نفس البيانات من اتحاد arcoGEN كما هو مذكور أعلاه (3177 مريض في الركبة والورك و 4894 من السكان الضابطين). تستغل طرق الاقتراض المعلومات المتعلقة بأنماط الارتباط متعدد العلامات (اختلال التوازن) من قواعد البيانات المتاحة للجمهور ، مثل مشروع HapMap الدولي أو دراسات إعادة تسلسل سياتل SNPs ، ومؤخراً مشروع 1000 جينوم ، 73 لتقدير أو "نسب" المريض الفردي أو التحكم في الأنماط الجينية في SNPs غير المصنفة ، وتقييم الأنماط الجينية المقدرة للارتباط مع النمط الظاهري. ثم تم استخدام البيانات المحسوبة للكشف عن مواقع المخاطر غير المحددة سابقًا. من خلال النسخ المتماثل على نطاق واسع ، كان من الممكن إنشاء ارتباط قوي مع SNPs في خط خلية MCF.2 المشتق يشبه التسلسل المحول (MCF2L). 59 وصلت الإشارة العليا rs11842874 إلى مجموع OR1.17 (95٪ CI 1.11–1.23) ، ص = 2.1 × 10 8 عبر إجمالي 19041 حالة الزراعة العضوية و 24504 عنصر تحكم من أصل أوروبي (الجدول 24.2). MCF2L يشفر عامل تبادل نيوكليوتيدات الجوانين الخاص بـ rho ، ولا يزال دوره في الزراعة العضوية غير واضح.

حدد التحليل التلوي GWAS على 78000 فرد متغيرًا كبيرًا للجينوم (rs6094710) في NCOA3 الجين (OR = 1.28 95٪ CI 1.18–1.39 ص = 7.9 × 10 9). 65 هذا ص- تم تحسين القيمة بعد التحليل المشترك للاكتشاف (ص = 5.6 × 10 8) ومتابعة الدراسات (ص = 7.3 × 10 −4). ظل موقعان مرتبطان بشكل موحٍ: rs5009270 في 7q31 (OR = 1.10.1) ص = 9.9 × 10 −7) و rs3757837 (OR = 1.27 ص = 2.2 × 10 6 في تحليل خاص بالذكور) 62 (الجدول 24.2).

A GWAS على الورك OA ، باستخدام بيانات من دراسة كسور هشاشة العظام عند الرجال ودراسة كسور هشاشة العظام ، تم تكرارها في خمس دراسات مستقلة. يقع rs788748 SNP بالقرب من IGFBP3 كان الجين مهمًا على مستوى الجينوم في هذا التحليل وارتبط بانخفاض خطر الإصابة بـ OA الورك (OR = 0.71 ص = 2.0 × 10 8). على الرغم من تكرار الارتباط في جميع الدراسات الخمس ، فقد ضعفت الإشارة بعد التكرار ، مما يشير إلى نتيجة إيجابية خاطئة محتملة (OR = 0.92 ص = 0.020). على الرغم من ذلك ، تم اقتراح دور هذا المتغير والجين في الزراعة العضوية من خلال نتائج دراسات التحقق من الصحة الوظيفية. 63 مزيد من النسخ المتماثل ضروري ، بشكل مثالي مع أحجام عينات أكبر ، لتأكيد أكثر ثقة بدور هذا المتغير في OA 63 (الجدول 24.2).

تم إجراء اختبار GWAS على سمك الغضروف عند الورك باستخدام بيانات من دراسة روتردام. ارتبط SNP في جين DOT1L بقوة بـ mJSW في الورك 74. بعد التكرار في الأفواج المستقلة في المملكة المتحدة ، تم تحقيق حجم التأثير الجيني الإجمالي (معبرًا عنه كمعامل انحدار بيتا) يبلغ 0.09 مم / أليل (ص = 1.1 × 10 11 بعد التحليل التلوي). 74 ارتبط أليل خطر انخفاض mJSW في هذا SNP لاحقًا بزيادة خطر الإصابة بالورك OA بنسبة 10 ٪ (ص = 8.8 × 10 8). وصل هذا التأثير إلى أهمية واسعة في الجينوم عند الذكور (OR = 1.17 95٪ CI 1.11–1.23 ص = 7.8 × 10 9) ، ولكنها كانت ذات أهمية اسمية فقط في النساء ذوات حجم التأثير الصغير (OR = 1.05) ، بما يتفق مع مثنوية الشكل الجنسي التي شوهدت في بعض أشكال الورك OA 66 (الجدول 24.2).

كشف GWAS الأول للإبلاغ عن نتائج مهمة على مستوى الجينوم من أجل OA اليدوي عن SNP (rs3204689) في ALDH1A2 أن يرتبط الجين ارتباطًا وثيقًا بزيادة خطر الإصابة بالزراعة العضوية باليد في مجموعة اكتشاف آيسلندية (OR = 1.51 ، ص = 3.99 × 10 10). تم تكرار هذه النتيجة في مجموعات من المملكة المتحدة وهولندا ، مما يدل على تحسن الارتباط وزيادة كبيرة في خطر الإصابة بزراعة اليد (OR = 1.46 ، ص = 1.10 × 10 11). في استنساخ السيليكو وجد ارتباطًا مهمًا مع هذا البديل للركبة OA ، ولكن ليس الورك OA. ومن المثير للاهتمام أن هذا كان تأثيرًا وقائيًا (OR = 0.95 ، ص = 0.044) ، يظهر عكس التأثير على اليد OA. فوجئ المؤلفون بهذه النتيجة حيث أشارت الأدبيات سابقًا إلى وجود علاقة وثيقة بين اليد والركبة OA 67 (الجدول 24.2).


التنميط الجيني SNP غير الباضع ميسور التكلفة والفعال باستخدام تسلسل الأمبليكون عالي الإنتاجية

أصبحت طرق التنميط الجيني غير الغازية عناصر أساسية لأبحاث الحياة البرية على مدى العقدين الماضيين ، ولكن اعتمادها على نطاق واسع محدود بسبب التكاليف المرتفعة ومعدلات النجاح المنخفضة ومعدلات الخطأ العالية. قد تؤدي المعلومات المفقودة عندما يكون نجاح التنميط الجيني منخفضًا إلى تقليل الدقة في كثافات أعداد الحيوانات مما قد يؤدي إلى تضليل إجراءات الحفظ والإدارة. توفر الأشكال المتعددة للنيوكليوتيدات الفردية (SNPs) بديلاً واعدًا للسواتل الدقيقة المستخدمة تقليديًا حيث تسمح SNPs بتضخيم شظايا الحمض النووي الأقصر ، وتكون أقل عرضة لأخطاء التنميط الجيني ، وتنتج نتائج يمكن مشاركتها بسهولة بين المختبرات. هنا ، نحدد بروتوكولًا تفصيليًا للتنميط الجيني SNP غير الغازي والفعال من حيث التكلفة والدقيق باستخدام تسلسل amplicon متعدد الإرسال للغاية المحسن للحمض النووي المتدهور. لقد تحققنا من صحة هذه الطريقة لتحديد الهوية الفردية عن طريق التنميط الجيني ل 216 خدشة و 18 شعرة و 15 أنسجة من ذئاب القيوط (كانيس لاتران). كان معدل نجاح التنميط الجيني لعينات scat 93 ٪ ، و 100 ٪ للشعر والأنسجة ، مما يمثل زيادة كبيرة مقارنة بالدراسات السابقة القائمة على الأقمار الصناعية بتكلفة أقل من 5 دولارات لكل تكرار PCR (باستثناء العمالة). تم تأكيد دقة الأنماط الجينية بشكل أكبر في تلك الأنماط الجينية من الخدوش المطابقة المعروفة ، وكانت ذئاب القيوط ذات طوق GPS موجودة دائمًا داخل أراضي الفرد المعروف. نوضح أيضًا أن المستويات المختلفة من مضاعفة الإرسال أدت إلى نتائج مماثلة ، ولكن استراتيجيات تنظيف منتج تفاعل البوليميراز المتسلسل (PCR) يمكن أن يكون لها تأثيرات كبيرة على نجاح التنميط الجيني. من خلال جعل التنميط الجيني غير الباضع أكثر تكلفة ودقة وفعالية ، قد يسمح هذا البحث بزيادة كبيرة في استخدام الأساليب غير الغازية لمراقبة وحفظ مجموعات الحياة البرية المجانية.


طريقة بديلة لطباعة الجنس البشري

ملخص الاقتباس: تحديد جنس العينة البيولوجية يتم تحديده بشكل تقليدي من خلال تضخيم تفاعل البوليميراز المتسلسل اميلوجينين الجينات. في هذه الدراسة ، يقوم Maxeiner وآخرون بالتحقيق في صحة استخدام الجنس باستخدام نيوروليجين -4، وهو جين مرتبط بالتوحد ، ويقدم طريقة بديلة باستخدام نظام التنميط الجيني rhAmp SNP.

خلفية

يعد تحديد هوية جنس العينة جزءًا مهمًا من مجموعة واسعة من مجالات البحث. تحليل الطب الشرعي البشري ، وأبحاث علم الوراثة الحيوانية التي تركز على التربية الاستراتيجية للماشية ، والمختبرات التي تستخدم نماذج الفئران لجميع أنواع البحوث البيولوجية ، كلها تستفيد من تحديد الجنس على أساس الحمض النووي. لعقود من الزمان ، كان تحديد الجنس يعتمد على وجود SRY الجين الموجود على الكروموسوم Y باستخدام PCR. لسوء الحظ ، فإن غياب SRY الجين لا يضمن أن العينة أنثى ، وهذه التجارب تستخدم SRY تفتقر إلى الرقابة الداخلية. استخدام اميلوجينين الجينات (AMELX / Y) للتمايز الجنسي يبدو أنه يحل هذه المشكلة ، حيث أنها مترجمة في كل من الكروموسومات X و Y. نيوروليجين -4 (NLGN4X / ص) لها خصائص مماثلة ، تظهر على كل من الكروموسومات الجنسية ، مما يبرز إمكانية استخدام هذه الجينات في تحديد الجنس.

PCR هي الطريقة التقليدية المفضلة لتحديد الجنس. عندما تحب الجينات NLGN4X / ص تحتوي على طفرات متعددة ، قد لا يكون تفاعل البوليميراز المتسلسل القياسي كافيًا للتمييز بين نسختين من الجينات. يتغلب نظام التنميط الجيني rhAmp & trade SNP على التحدي المتمثل في العديد من الأشكال المتعددة باستخدام البادئات المحجوبة لتقليل التضخيم غير المحدد. يشتمل الطرف 3 'من بادئات rhAmp على مجموعة مانعة تمنع التمدد ما لم يحدث الانقسام وإزالة الانسداد بواسطة إنزيم RNase H2. يتعرف إنزيم RNase H2 على قاعدة RNA هذه فقط إذا تم تهجينها إلى مكملتها المثالية ، مما يؤدي إلى انقسام وتنشيط التمهيدي (انظر الشكل).

طريقة

تم تنزيل معلومات تسلسل الجينات من قاعدة بيانات NCBI. تم استخراج الحمض النووي من 6 عينات من الخلايا الشدقية و 105 عينة من دم الإنسان. تم استخدام بادئات PCR لتحديد منطقة الإدراج / الحذف (indel). تم إجراء التنميط الجيني SNP باستخدام نظام التنميط الجيني rhAmp SNP بدءًا من تحديد الاشعال باستخدام أداة تصميم التنميط الجيني rhAmp

نتائج

لكي يميز تفاعل البوليميراز المتسلسل التقليدي بين الجنسين ، قد لا يحتوي التسلسل على قواعد غامضة قد تمنع التلدين التمهيدي ، ويجب تمييز الأليلين ، X و Y ، على هلام الاغاروز باستخدام الرحلان الكهربائي. على عكس PCR التقليدي ، يسمح نظام التنميط الجيني rhAmp SNP بالتغيرات في التسلسل.

لاختبار ما إذا كان NLGN4 يمكن استخدامها لتحديد الجنس باستخدام PCR التقليدي ، Maxeiner ، وآخرون ، واستهدفت منطقة indel على الفور في بداية كودون البدء. حيث NLGN4X (381 نقطة أساس) ما يقرب من ضعف طول NLGN4Y (187 نقطة أساس) ، يمكن استخدام PCR التقليدي للتمييز بين الأليلين باستخدام الاغاروز الكهربائي للهلام.

ركز الباحثون على أشكال النوكليوتيدات المفردة (SNPs) عند الاختبار NLGN4 باستخدام rhAmp SNP Genotyping System. تم تحديد جميع الاختبارات الثلاثة التي تم تصميمها بواسطة أداة تصميم التنميط الجيني rhAmp بنجاح NLGN4X. كان أحد المقايسات قادرًا على فصل العينات إلى مجموعات للتمييز بين الأليلات الجنسية.

هذه الدراسة هي الأولى من نوعها للتحقيق في التنميط الجيني rhAmp كوسيلة لتحديد الجنس. كان نظام التنميط الجيني rhAmp SNP قادرًا على تحديد العينات والجنس بنفس معدل اختبار PCR التقليدي ولكنه يتضمن ميزة القياس. يمكن توسيع نطاق نظام التنميط الجيني rhAmp SNP ليشمل تعدد الإرسال والسماح بفحص الإنتاجية العالية. تعدد الأشكال في NLGN4X / ص كانت علامات صالحة للتمييز بين الأليلات الجنسية. يمكن استخدام هذه الجينات بالاقتران مع ، أو كبديل ، أزواج الجينات الأخرى الخاصة بالجنس مثل AMELX / Y. يمكن تطبيق استراتيجية rhAmp SNP على أزواج الجينات الأخرى الخاصة بالجنس أيضًا.


هل الحصول على البيانات الأولية وتفسيرها معقد؟

الجواب هو لا. بمجرد تحميل صفيف SpectroCHIP في محلل MassARRAY ، حيث يتم تشعيع بلورات التحليل وتأينها من أجل تسريع الجزيئات المشحونة إلى كاشف. يحدث الانفصال حسب وقت الرحلة ، وهو متناسب لكتلة الجزيئات الفردية.

تستغرق العملية برمتها أقل من 50 دقيقة لتحليل 384 عينة. في هذه الصورة ، يمكننا أن نوضح لك كيف يبدو طيفًا كاملاً لتجربة اختبار 36 من نوع plex. تشير القمم المميزة إلى فصل 24 Da في الأليلات غير المتجانسة (B) من SNP المعني مقارنة بالنمط الجيني متماثل الذروة الفردي (C).

من النوع يقوم البرنامج تلقائيًا بإنشاء تقارير تحدد أليلات SNP (متماثلة اللواقح أو غير متجانسة) في كل عينة.


Bioline Scholar & # 8211 Human Genes، Genetics، Genomes (Special ASHG 2012 Edition)

الاجتماع السنوي للجمعية الأمريكية لعلم الوراثة البشرية 2012

كان Bioline مرة أخرى عارضًا (#Booth 1324-1326) في الاجتماع السنوي للجمعية الأمريكية لعلم الوراثة البشرية (ASHG) الذي عقد في سان فرانسيسكو في نوفمبر. استقطب أكبر اجتماع علم الوراثة البشرية في العالم ، ASHG 2012 أكثر من 7000 مندوب لمناقشة أحدث التطورات في البحوث الأساسية والسريرية.

تضمنت الجلسات موضوعات مثل علم اللاجين المقارن ، وتسلسل الإكسوم المبكر في السمات المعقدة ، والتعرف على نطاق واسع لمنظمي الترجمة ، والدراسات الجينية والوظيفية المتكاملة للمتغيرات المسببة للأمراض.

كشفت Bioline عن جناحها الجديد في المعرض في المؤتمر ، حيث التقى ممثلونا بالعلماء وناقشوا الحلول لتحديات البيولوجيا الجزيئية. ألقى أخصائي Bioline PCR ، الدكتور Sven Bocklandt سلسلة من المحادثات التي لقيت استحسانًا وتحفيزًا على التفكير حول بعض منتجاتنا الحديثة ، بما في ذلك SensiFAST ™ و MyFi ™ و MyTaq ™ DNA polymerases. تم تقديم نتائج مثيرة من كل من الأوراق المنشورة وبعض التجارب غير المنشورة من المجتمع العلمي Bioline ، بما في ذلك نتائج من Bioline PCR Challenge.

تمشيا مع ASHG 2012 ، يخصص عالم Bioline هذا الشهر & # 8217s لعلم الوراثة البشرية. يسعدنا أن نسلط الضوء على مجموعة مختارة من الأوراق الحديثة التي تعرض منتجات Bioline ، وهي مناسبة تمامًا للدراسات الجينية والجينية على نطاق صغير وكبير في البشر.

BIO-X-ACT ™ طويل DNA بوليميريز

تسبب الطفرات في MTM1 (myotubularin 1) اعتلال عضلي عضلي أنبيبي مرتبط بـ X يصيب 1 من كل 50000 ذكر. عند الولدان أو الرضع ، تتأثر الحركة والتنفس بشدة. طور المؤلفون قاعدة بيانات خاصة بـ MTM1 للمتغيرات الجينية ، مع 474 طفرة محددة من 472 مريضًا. كشف تسلسل الجيل التالي (Illumina HiSeq) وتحليل (كدنا) عن وجود نسخة اندماج جديدة لـ MTM1 / MAMLD1 في حالة واحدة.

طقم التوليف (كدنا)

غالبًا ما يُصاب الأطفال المصابون بالتهاب الشبكية الصباغي المرتبط بالكروموسوم X (XLRP) بالعمى بحلول العقد الثاني من العمر. تم تعيين شكل حاد من XLRP ، RP23 ، مسبقًا إلى فاصل زمني 10.71 ميجا بايت على Xp22.31-22.13 ، يحتوي على 62 جينًا. باستخدام NGS المستهدفة (Illumina) ، حدد المؤلفون طفرة داخلية عميقة في OFD1 باعتبارها السبب الأكثر احتمالية لـ RP23. ينتج عن إدخال exon خفي نسخة شاذة ومستويات مخفضة من نسخة مقسمة بشكل صحيح. ومن المتوقع أن يؤدي ذلك إلى اقتطاع شديد للبروتين وانخفاض مستويات البروتين الطبيعي.

إنزيم BIOTAQ ™ DNA Polymerase

تم فحص الأساس الجيني لقابلية الإصابة بالملاريا لدى السكان الفيتناميين عن طريق التنميط الجيني SNP بواسطة باحثين من جامعة أكسفورد واتحاد MalariaGen. تم الإبلاغ عن بيانات من 65 SNPs في 42 جينًا مرشحًا للملاريا في 956 حالة ملاريا شديدة و 2350 عنصر تحكم من فيتنام. ارتبطت المتغيرات في ستة جينات (ICAM1 و IL1A و IL17RC و IL13 و LTA و TNF) التي تشفر الالتصاق والجزيئات المؤيدة للالتهابات بالملاريا الشديدة.

BioMix ™ أحمر

الحثل العضلي الوجهي العضدي (FSHD) ، الذي يتميز بضعف العضلات وهزالها ، يرتبط بتقصير تيلومير chr 4q35 بسبب حذف التكرار الترادفي D4Z4 (FSHD1) أو تغييرات مثيلة الحمض النووي لـ D4Z4 (FSHD2). باستخدام تسلسل الإكسوم (Illumina NGS) ، حدد المؤلفون طفرتين ممرضتين معروفتين في CAPN3 ، مما يشير إلى حالة ضمور عضلي من النوع 2A (LGMD2A) بدلاً من FSHD2. استنتج المؤلفون أن "التشخيص بالتسلسل" للـ FSHD قد يكون أكثر شيوعًا في مختبرات الجينات السريرية في جميع أنحاء العالم.

تم إنشاء مكتبة جينية بشرية مصفوفة تضم 115000 نسخة من PAC. أظهرت الدراسات الوظيفية مع استنساخ PAC المحتوي على p53 في خلايا ساركوما عظمية بشرية p53 خالية من فائدة أعضاء المكتبة الفرديين في نماذج ثقافة الخلايا البشرية. يمكن استخدام المكتبة للتحقق من صحة الجينات المرشحة التي تم تحديدها بواسطة GWAS وللعلاج الجيني في الاضطرابات المتنحية المختلفة.

Immomix ™

مرض شاركو ماري توث (CMT) هو اضطراب وراثي لخلل وظيفي في الأعصاب الطرفية يؤدي إلى الخدر والضعف. ارتبطت الطفرات في أربعة جينات ترميز مركب aminoacyl-tRNA (ARS) بـ CMT. وجدت هذه الدراسة من جامعة ميشيغان أن طفرة pArg329 AARS هي طفرة متكررة لفقدان الوظيفة تنشأ بسبب نزع الأمين بوساطة المثيلة لثنائي نيوكليوتيد CpG.

تقديم قاعدة بيانات منشورات Bioline Scholar

Bioline Scholar & # 8211 من Bioline: شركة PCR

إذا كنت & # 8217re مهتمًا بمعرفة المزيد عن مجالات ومجالات البحث التي تم فيها استخدام منتجات Bioline لمزيد من المعرفة ، فقد أضفنا صفحة Bioline Scholar إلى موقعنا على الويب تسرد الأوراق والمنشورات التي تكون فيها كواشف البيولوجيا الجزيئية الخاصة بنا متميز.

يمكنك البحث عن المنشورات حسب المؤلف والعنوان والموضوع والمنتج ويحتوي الأرشيف على أوراق من 1994 حتى الوقت الحاضر. تسرد قاعدة بيانات Bioline Scholar حاليًا وتوفر روابط للمنشورات حيث تم إجراء البحث باستخدام منتجات Bioline التالية:

هذا هو & # 8217s لمدونة Bioline في عام 2012 - تحيات الموسم & # 8217s لجميع عملائنا والقراء على حد سواء ، من جميع في Bioline - نراكم في عام 2013!


شاهد الفيديو: SNP Genotyping Technologies (يوليو 2022).


تعليقات:

  1. Wade

    تحت الحكاية الخيالية للحلم ، سيدخل منزلك

  2. Achak

    إجابة سريعة ، علامة على الذكاء :)

  3. Faeshura

    أنا أتفق معك ، أشكرك على مساعدتكم في هذا الأمر. كما هو الحال دائما كل عبقري بسيط.



اكتب رسالة