معلومة

ما هي العملية الصحيحة لوصف إعادة تركيب V (D) J؟ عملية RAG-1 و RSS المتكررة

ما هي العملية الصحيحة لوصف إعادة تركيب V (D) J؟ عملية RAG-1 و RSS المتكررة


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أنا أدرس تأشيب V (D) J. أعتقد أن لدي كتابين غير متوافقين حول شرح العملية. وهو الحق؟

  • في علم الأحياء الجزيئي للخلية 5th Ed. ، أولاً RAG (-1؟) يتحد مع RSSs للجينات V و J بشكل مستقل. بعد ذلك ، يتم تشكيل حلقة دبوس الشعر عن طريق تقشير عشوائي (؟) RAGs.
  • في علم الأحياء المناعي الثامن من Janeway ، يحتوي مجمع RAG (RAG-1 و RAG-2) على موقعين لـ RSSs من البداية. وفي الشكل ، يتم تجنيد الجين V أولاً لموقع ما. يتحد جين J مع مركب RAG بعد جين V.

مقتطفات من المناعة الخلوية والجزيئية، ED 8th، p181-182. لا تصوت لي ، لقد اعتقدت أن هذا النص يقدم شرحًا جيدًا ومحدثًا.

آلية إعادة التركيب V (D) J

تمثل إعادة ترتيب جينات Ig و TCR نوعًا خاصًا من حدث إعادة تركيب الحمض النووي غير المتماثل ، بوساطة الأنشطة المنسقة للعديد من الإنزيمات ، بعضها موجود فقط في تطوير الخلايا الليمفاوية ، في حين أن البعض الآخر عبارة عن إصلاح شامل للكسر المزدوج للحمض النووي (DSBR) الانزيماتعلى الرغم من أن آلية إعادة التركيب V (D) J مفهومة جيدًا إلى حد ما وسيتم وصفها هنا ، إلا أنه لا يزال يتعين تحديد كيفية إتاحة الوصول إلى مواقع محددة بدقة للآلات المشاركة في إعادة التركيب. من المحتمل أن يتم تنظيم إمكانية الوصول إلى موقعي Ig و TCR إلى الإنزيمات التي تتوسط في إعادة التركيب في تطوير الخلايا B و T من خلال عدة آليات ، بما في ذلك التعديلات اللاجينية في بنية الكروماتين والحمض النووي كما تمت مناقشته سابقًا ، ونشاط النسخ القاعدية في مواقع الجينات . يمكن تقسيم عملية إعادة التركيب V (D) J إلى أربعة أحداث متميزة تتدفق بالتتابع من واحد إلى الذي يليه (الشكل 8-10):

1. سينابسيس: أجزاء من الكروموسوم الذي يوجد عليه جين مستقبل المستضد تكون في متناول آلة إعادة التركيب. يتم الجمع بين مقطعين ترميز محددين و RSSs المتجاورتين معًا بواسطة حدث حلقات الكروموسومات ويتم الاحتفاظ بها في موضعها من أجل الانقسام اللاحق والمعالجة والانضمام.

2. انشقاق: يتم إنشاء الفواصل المزدوجة التي تقطعت بها السبل إنزيميًا عند تقاطعات تسلسل ترميز RSS بواسطة آلية خاصة باللمفويد. يشكل البروتينان المشفران بواسطة جينات خاصة باللمفويد ، يُطلق عليهما جين تنشيط إعادة التركيب 1 وجين تنشيط إعادة التركيب 2 (RAG1 و RAG2) ، معقدًا يحتوي على جزيئين من كل بروتين ، ويلعبان دورًا أساسيًا في إعادة التركيب V (D) J. يُعرف مجمع Rag-1 / Rag-2 أيضًا باسم V (D) J recombinase. يتعرف بروتين Rag-1 ، بطريقة تشبه نوكلياز التقييد ، على تسلسل الحمض النووي عند التقاطع بين heptamer وقطعة الترميز و يشقها ، لكنها تنشط إنزيميًا فقط عندما تترافق مع بروتين Rag-2. قد يساعد بروتين Rag-2 في ربط Rag-1 / Rag-2 tetramer ببروتينات أخرى ، بما في ذلك عوامل إمكانية الوصول التي تجلب هذه البروتينات إلى مواقع جينية محددة لمستقبلات مفتوحة في أوقات محددة وفي مراحل محددة من تطور الخلايا الليمفاوية. يساهم Rag-1 و Rag-2 في تجميع أجزاء الجينات معًا أثناء عملية طي الكروموسومات أو التشابك العصبي. ثم يصنع Rag-1 شقًا (على خيط DNA واحد) بين نهاية الترميز و heptamer. ثم تهاجم 3'OH التي تم إطلاقها من نهاية الترميز رابطة فسفودايستر على خيط الحمض النووي الآخر ، وتشكل دبوس شعر تساهمي. لا تشكل نهاية الإشارة (بما في ذلك heptamer وبقية RSS) دبوس شعر ويتم إنشاؤه كنهاية حادة للحمض النووي مزدوج الشريطة لا تخضع لمزيد من المعالجة. ينتج عن هذا الفاصل المزدوج الذي تقطعت به السبل حدوث دبوس شعر مغلق من مقطع ترميز واحد يتم تثبيته في موضعه على دبوس الشعر المغلق لطرف الترميز الآخر ونهايتين من إعادة التركيب الحادة توضع بجوار بعضهما البعض. Rag-1 و Rag-2 ، بصرف النظر عن إنشاء فواصل مزدوجة تقطعت بهم السبل ، تمسك أيضًا بنهايات دبوس الشعر والنهايات الحادة معًا قبل تعديل نهايات الترميز وعملية الربط.

جينات RAG هي جينات ليمفاوية محددة ويتم التعبير عنها فقط في تطوير الخلايا البائية والتائية. يتم التعبير عن بروتينات Rag بشكل رئيسي في مراحل G0 و G1 من دورة الخلية ويتم تعطيلها في الخلايا المتكاثرة. يُعتقد أن تقييد انقسام الحمض النووي وإعادة التركيب إلى مرحلتي G 0 و G1 يقلل من خطر توليد فواصل الحمض النووي غير المناسبة أثناء تكرار الحمض النووي أو أثناء الانقسام. الفئران التي لا تحتوي على Rag1 وظيفي أو Rag2genes (فئران Ragknockout) تفشل في تطوير الخلايا الليمفاوية B أو T ، ونقص Rag-1 أو Rag-2 هو أيضًا سبب نادر لـ SCID ، حيث يفتقر المرضى أيضًا إلى جميع الخلايا الليمفاوية.

3. افتتاح دبوس الشعر ونهاية المعالجة: يتم تعديل نهايات التشفير المكسورة عن طريق إضافة أو إزالة القواعد ، وبالتالي يتم إنشاء تنوع أكبر. بعد تكوين فواصل مزدوجة الشريطة ، يجب حل دبابيس الشعر (فتحها) عند تقاطعات التشفير ، ويمكن إضافة القواعد إلى نهايات التشفير أو إزالتها منها لضمان تنوع أكبر. Artemisis هو نوكلياز داخلي يفتح دبابيس الشعر في نهايات الترميز. في حالة عدم وجود أرتميس ، لا يمكن فتح دبابيس الشعر ، ولا يمكن إنشاء الخلايا التائية والبائية الناضجة. الطفرات في ARTEMIS هي سبب نادر لـ SCID ، على غرار المرضى الذين يعانون من طفرات RAG1 أو RAG2. (انظر الفصل 21). يضيف إنزيم خاص بالليمفويد ، يسمى ترانسفيراز ديوكسينوكليوتيديل (TdT) ، قواعد لنهايات الحمض النووي المكسورة وستتم مناقشتها لاحقًا في الفصل في سياق التنوع الوصلي.

4. الانضمام: نهايات التشفير المكسورة بالإضافة إلى نهايات الإشارة يتم تجميعها وربطها من خلال عملية إصلاح كسر مزدوج تقطعت بهم السبل موجودة في جميع الخلايا والتي تسمى الانضمام إلى النهاية غير المتجانسة. يشارك عدد من العوامل في كل مكان في الانضمام إلى نهايات غير متجانسة. Ku70 و Ku80 عبارة عن بروتينات مرتبطة بنهاية الحمض النووي ترتبط بالفواصل وتوظف الوحدة الفرعية التحفيزية لبروتين كيناز المعتمد على الحمض النووي (DNA-PK) ، وهو إنزيم لإصلاح الحمض النووي مزدوج الشريطة. هذا الإنزيم معيب في الفئران التي تحمل طفرة عوز المناعة المشترك الشديدة (scid) ، كما تم اكتشاف طفرات في الجين المشفر لهذا الإنزيم في مرضى SCID البشري (انظر الفصل 21). مثل الفئران التي تعاني من نقص Rag ، تفشل scidmice في إنتاج الخلايا الليمفاوية الناضجة. يقوم DNA-PK أيضًا بالفسفرة وتنشيط Artemis ، والتي ، كما ذكرنا سابقًا ، تشارك في المعالجة النهائية. يتم التوسط في ربط الأطراف المكسورة المعالجة بواسطة DNA ligase IV و XRCC4 ، والأخير عبارة عن وحدة فرعية غير محفزة ولكنها أساسية من ligase.

الشكل 8-10 ، المناعة الخلوية والجزيئية ، 8 هـ ، ص 182.


مقايسة مراسل الفلورسنت الكمية الجديدة لأهداف RAG ونشاط RAG


تشكل جينات تنشيط إعادة التركيب (RAG) 1 و 2 إعادة التركيب الخاصة بالموقع التي تتوسط إعادة التركيب V (D) J ، وهي عملية تحرير الحمض النووي اللازمة لتطوير الخلايا الليمفاوية والمسؤولة عن ذخيرتها المتنوعة من مستقبلات المستضد. يرتبط نشاط RAG الخاطئ بتغيير الجينوم وهو مسؤول عن الأورام اللمفاوية المختلفة. علاوة على ذلك ، فإن العديد من الأورام غير اللمفاوية تعبر عن RAG خارج الرحم. مطلوب أداة عملية وقوية لإجراء تقييم كمي لنشاط RAG وتسجيل تسلسل إشارات RAG-Recognition المفترض (RSS) في مجالات علم المناعة ، وعلم الأورام ، والعلاج الجيني ، والتنمية. نحن هنا نبلغ عن التوصيف التفصيلي لمراسل جديد قائم على التألق لنشاط RAG ، يُسمى GFPi ، وهي أداة تسمح بقياس كفاءة إعادة التركيب (RE) عن طريق تحليل التدفق الخلوي البسيط. يمكن إنتاج GFPi على حد سواء كبلازميد لتجارب تعداء عابرة في خطوط الخلايا أو كفيروس قهقري للتكامل المستقر في الجينوم ، وبالتالي دعم خارج الجسم الحي و في الجسم الحي دراسات. فحص GFPi بأمانة نشاط RAG الداخلي والخارجي كما تم اختباره في الخلايا الليفية المعدلة وراثيًا وخطوط الخلايا المشتقة من الورم وتطوير خلايا ما قبل B والخلايا المكونة للدم. كما نجح اختبار GFPi في تصنيف RE للعديد من أزواج RSS ، بما في ذلك حسن النية RSS المرتبطة بمقاطع V (D) J ، أو تسلسل الإجماع الاصطناعي المعدل أو غير المعدل في نيوكليوتيدات معينة معروف أنها تؤثر على كفاءتها ، أو RSS المشفرة المتضمنة في التنشيط المعتمد على RAG للجينات الورمية. يتحقق عملنا من صحة مراسل GFPi كأداة كمية عملية لدراسة نشاط RAG وكفاءات RSS. يجب أن يصبح مفيدًا لدراسة V (D) J بوساطة RAG وإعادة الترتيب الشاذة ، والتزام النسب ، وتطور الفقاريات.


البحوث الأصلية المادة

جوستينا ميكا 1 ، سيلويا كاباجيك 2 ، كريستوف بديع 2 ، جوانا بولانسكا 1 و سيرج م. كان & # x000E9ias 3 & # x0002A
  • 1 قسم تعدين البيانات ، جامعة سيليسيان للتكنولوجيا ، غليفيتسه ، بولندا
  • 2 مجموعة آليات السرطان والمؤشرات الحيوية ، قسم التأثيرات الإشعاعية ، مركز الإشعاع والمخاطر الكيميائية والبيئية الصحة العامة إنجلترا شيلتون ، ديدكوت ، المملكة المتحدة
  • 3 Universit & # x000E9 Grenoble Alpes، CEA، CNRS، IRIG-LCBM، Grenoble، France

يتم تجميع الجينات المشفرة للوحدات الفرعية لمستقبل الخلايا التائية المستضدية (TR) في الخلايا التوتية من جينات V و D و J المنفصلة عن طريق عملية إعادة التركيب الخاصة بالموقع. مطلوب رقابة صارمة على هذا النشاط لمنع أحداث إعادة التركيب التي قد تكون ضارة. جينات V و D و J محاطة بدوافع نيوكليوتيدات شبه محفوظة تسمى تسلسل إشارة إعادة التركيب (RSSs). يتم البدء في إعادة التركيب V (D) J من خلال الإدخال الدقيق لكسر DNA مزدوج الخيط تمامًا عند حدود الجينات و RSSs الخاصة بها بواسطة RAG recombinase. لذلك يتم فصل RSSs ماديًا عن منطقة ترميز الجينات قبل تجميع جين TR المعاد ترتيبه. خلال التنميط العالي للإنتاجية لجينات TRB في الفئران ، حددنا جينات TRB المعاد ترتيبها حيث تم الاحتفاظ بجزء أو كل من RSS المرافقة في مفاصل ترميز V-D أو D-J. في بعض الحالات ، نتج هذا الاحتفاظ بالحمض النووي للخطوط الجرثومية من استخدام RSS البديل المنبع. ومع ذلك ، حددنا أيضًا تسلسلات TRB حيث حدث الاحتفاظ بالحمض النووي للخطوط الجرثومية في غياب بديل RSS ، مما يشير إلى أن نشاط RAG كان مستهدفًا بشكل خاطئ أثناء إعادة التركيب. تم تحديد أحداث مماثلة أيضًا في جينات TRB و TRG التي أعيد ترتيبها بشريًا. يوضح استخدام RSSs البديلة أثناء إعادة التركيب V (D) J مدى تعقيد تفاعلات RAG-RSSs أثناء إعادة تركيب V (D) J. في حين أن تواتر الأخطاء الناتجة عن نشاط RAG الموجه بشكل خاطئ منخفض جدًا ، فإننا نعتقد أن أخطاء RAG هذه قد تكون أصل عمليات الانتقال السرطانية وتشكل تهديدًا للاستقرار الوراثي في ​​الخلايا الليمفاوية النامية.


الكيمياء الحيوية لمجمع RAG

يتكون مركب RAG ، الذي يُسمى أحيانًا V (D) J recombinase ، من عديد ببتيدات ، RAG1 و RAG2 [17]. إن التعبير عن بروتينات RAG1 و RAG2 محدود في تطوير الخلايا B و T ، مما يقيد إعادة التركيب V (D) J بنسب وتوقيت محدد بطريقة محددة. منذ اكتشاف جينات RAG ، تم إجراء كيمياء حيوية واسعة النطاق لمركب البروتين. يحتوي RAG1 على نموذج ربط DNA خاص بالتسلسل محفوظ (نموذج ربط nonamer ، NBD) وثلاثة أحماض أمينية حمضية تنسق الكاتيونات ثنائية التكافؤ (حافز DDE) الضرورية لتفاعل التحلل النووي (الشكل 2 أ) [18]. لا يمتلك RAG2 نشاطًا تحفيزيًا أو ارتباطًا بالحمض النووي يمكن اكتشافه في حد ذاته ، ومع ذلك يصبح نشاط التحلل النووي نشطًا فقط عندما يكون RAG1 و RAG2 معقدًا [19]. يحفز بروتين مجموعة B1 (HMGB1) و HMGB2 عالي الحركة الحركة نشاط انشقاق RAG في المختبر ، ومع ذلك فإن وظيفته في إعادة التركيب في الجسم الحي V (D) J أقل وضوحًا. يتم تحقيق انقسام الحمض النووي بواسطة مركب RAG من خلال سلسلة من الأحداث الجزيئية (الشكل 2 ب). أولاً ، يتعرف مجمع RAG على RSS ثم يقدم طريقة التقطيع في نهاية 5 لكل 12 أو 23RSS. يحفز مجمع RAG بعد ذلك الاسترة التبادلية لإنتاج دبابيس شعر DNA في نهايات التشفير ، مما يؤدي إلى DSBs. تحدث DSBs بكفاءة بين 12 / 23RSS (12/23 المشبك). تتكون الوحدة النشطة لمركب RAG من مغاير مغاير بما في ذلك 2 RAG1 و 2 RAG2 ومع ذلك ، فإن الترتيب الحركي لتفاعل RAG ليس واضحًا بعد [20-22]. قد ينفذ واحد RAG tetramer خطوة الشق في كل RSS ومن ثم قد يعمل اثنان من رباعي RAG معًا لإنشاء DSBs. أو قد يقوم RAG tetramer أولاً بربط موقعي RSS ثم يقوم بتحفيز كل من تشكيل DSB. بسبب قيود المقايسات البيوكيميائية ، استخدمنا المحاكاة الرياضية لإيجاد النماذج الحركية التي تناسب البيانات الحركية المحددة تجريبياً لفحص الانقسام في المختبر [23]. بناءً على هذا النهج ، من المتوقع أن يقوم أحد RAG tetramer بإدخال 12RSS و 23RSS في المشبك ، متبوعًا بالخدش ودبابيس الشعر (الشكل 2 ب).

الكيمياء الحيوية لمجمع RAG. أ نموذج لانقسام الحمض النووي بواسطة مجمع RAG. يربط مجمع RAG ويحفز التشققات عن طريق التحلل المائي في كل RSS في مجمع 12/23 المشابك. يهاجم 3′-OH من الخيط العلوي الشريط السفلي في وجود مركب RAG ، مما يؤدي إلى حدوث فواصل الحمض النووي المزدوجة الشريط. نهايات الترميز تشكل دبابيس شعر DNA ، بينما نهايات الإشارة نهايات حادة بـ 3′-OH. ب تنظيم المجال لبروتينات RAG الفئران. تحتوي المنطقة الأساسية RAG1 (a.a. 384-1،008) على مجال ربط nonamer (NBD a. تحتوي المنطقة غير الأساسية RAG1 على البنصر (RING) a.a. 299-330 واصبع الزنك A (ZFA) a.a. 353 - 374. المنطقة الأساسية RAG2 (a.a. 1-387) PHD plant homeodomain finger a.a. 414-481 موقع الفسفرة T490 بواسطة كيناز المعتمد على السيكلين ( يسار (< نص> right) _ < text> ) ، موقع الانتشار في كل مكان

داخل بروتينات RAG ، تسمى المناطق الضرورية لمقايسات الانقسام الكيميائي الحيوي في المختبر وفحوصات إعادة التركيب الخلوي V (D) J الأساسية RAG1 و RAG2 الأساسية (الشكل 2 أ) [17]. من ناحية أخرى ، تعد المناطق غير الأساسية لبروتينات RAG ضرورية لإعادة التركيب الفعال للمواضع الجينية V (D) J. الأهم من ذلك ، أن الطفرات في المناطق غير الأساسية تسبب SCID ، لكن وظائفها ليست مفهومة جيدًا [24]. تحتوي نهاية RAG1 N في المنطقة غير الأساسية على مجال إصبع RING يحتوي على نشاط يوبيكويتين ليجاز (E3) نفسه أو عندما يكون معقدًا مع بروتينات VprBP / DDB1 / Cul4A / Roc1 [25-27]. تم الإبلاغ عن أن هذه المنطقة تربط وتوجد في كل مكان هيستون H3 ، وربما تربط مجمع RAG بعملية إصلاح DSB. تلعب المنطقة غير الأساسية RAG2 في الطرف C دورًا في عدم استقرار الجينوم من خلال المساهمة في تمييز خصوصية التسلسل [28-30]. تحتوي هذه المنطقة أيضًا على موقع فسفرة لـ cyclin A-Cdk2 عند Thr490 وإصبع PHD [31]. يرتبط Thr490 والفاصل الزمني الممتد للأحماض الأمينية 499-508 بالتدمير الدوري لـ RAG2 في انتقال G1-S بواسطة Skp1-Cul1-Skp2 (Skp2-SCF) المعتمد على polyubiquitylation [32 ، 33]. نظرًا لأن إعادة التركيب V (D) J يحدث في المرحلة G1 ، فقد يعمل تدمير بروتين RAG لمنع نشاط RAG الشاذ خارج G1. يربط إصبع RAG2 PHD على وجه التحديد هيستون H3 ليسين 4 مفرط الميثيل ، مما يساهم في تكوين DSB الفعال ، والذي سنناقشه لاحقًا في هذه المراجعة [10-13].


نتائج

توليد وتوصيف إجهاد الفأر الذي يسمح بالتعطيل المشروط لـ RAG-2.

استراتيجية استهداف الجين وفحص الخلايا الجذعية الجنينية المؤتلفة بواسطة النشاف الجنوبي موضحة في الشكل 1 أ والشكل ب ، على التوالي. الشرط RAG-2 تم نقل الأليل (RAG-2 fl) إلى السلالة الجرثومية C57BL / 6 وتم تحليل الفئران المتحولة. تكون الخلايا الليمفاوية للخلايا البائية في BM of RAG-2 كانت الفئران fl / fl طبيعية ، وكان حجم تجمع الخلايا B المحيطي مشابهًا لحجم الفئران من النوع البري ، مما يشير إلى عدم وجود تداخل مع RAG-2 التعبير عن طريق إدخال الاثنين loxP المواقع (البيانات غير معروضة). لتوليد الفئران متماثلة اللواقح ل RAG-2 حذف (RAG-2 del / del) ، RAG-2 تم عبور الفئران fl / fl إلى الحذف سلالة ، والتي تسمح بحذف في كل مكان من loxP- قطع الجينات المحاطة بما في ذلك الخلايا الجرثومية 37. تطور الخلايا البائية والتائية في RAG-2 تم حظر الفئران del / del في مراحل الخلايا الموالية لـ B و pro-T ، مما أدى إلى إنتاج النمط الظاهري الكلاسيكي RAG-1 و RAG-2 الفئران بالضربة القاضية (29،30 بيانات غير معروضة).

الفئران من النمط الجيني RAG-2 fl / del ، Mx-cre ، حيث RAG-2 يمكن إحداث الحذف بكفاءة بواسطة IFN أو تم استخدام محفزه ، Poly (I) · Poly (C) 34 ، في تجاربنا الإضافية. 2 أسبوع بعد الحقن داخل الصفاق لـ Poly (I) · Poly (C) في البالغين RAG-2 fl / del ، الفئران Mx-cre ، تم استرداد عدد أقل قليلاً من خلايا BM من هذه الحيوانات مقارنةً بعناصر التحكم في القمامة المعالجة بالمثل. كانت حجرة الخلية المؤيدة لـ B220 المنخفضة CD43 + B في الحيوانات التجريبية قابلة للمقارنة مع عناصر التحكم ، في حين أن B220 منخفض CD43 - خلايا ما قبل B كانت غائبة بشكل أساسي ، مما يشير إلى كتلة من تطور الخلية B في مرحلة الخلايا المؤيدة لـ B (الشكل 1 ج). كانت خلايا B غير الناضجة B220 منخفضة IgM + في مستويات الخلفية ، بينما لم تتأثر خلايا B الناضجة B220 عالية IgM +. على غرار تطور الخلايا البائية في BM ، تم حظر تطور الخلايا التائية في الغدة الصعترية في مرحلة الخلايا التائية المؤيدة عند تحريض RAG-2 الحذف (البيانات غير معروضة). بالاتفاق مع العمر القصير للخلايا B غير الناضجة 12،14 ، تم تقليل حجرة الخلايا B غير الناضجة IgM + HSA في طحال الطفرات المعالجة بـ Poly (I) · Poly (C) إلى مستويات الخلفية (انظر الشكل 1). C عدد قليل من الخلايا عالية IgM + HSA في طحال الطفرات كانت في الغالب CD21 + وبالتالي من المفترض خلايا MZ B). كما هو الحال في الفئران البالغة ، تم حظر نمو الخلايا البائية أيضًا في مرحلة الخلايا المؤيدة لـ B في الفئران التي فيها RAG-2 تم حذفه عند الولادة أو في عمر 2 أسبوع (البيانات غير معروضة). في هذه الفئران وكذلك في تلك التي عولجت بالمحفز في سن البلوغ ، تم الحفاظ على كتلة نمو الخلايا البائية كما هو موضح في الشكل 1 ج طوال فترة الملاحظة بأكملها (انظر البيانات أدناه غير معروضة). كفاءة الحذف RAG-2 كان أليل fl في BM كما تم تحديده بواسطة تحليل النشاف الجنوبي قريبًا من 100 ٪ في كل من البالغين وحديثي الولادة ، بينما كان 90 ٪ في الطحال والخلايا في التجويف البريتوني (البيانات غير معروضة).

للتحقق من أن الكتلة المستحثة لتطور الخلايا البائية قد اكتملت بالفعل ، أعدنا تشكيل التوليف المشع تحت المميت RAG-1 - / - الفئران (التي تفتقر إلى الخلايا B و T) مع خلايا BM عمرها 13 أسبوعًا RAG-2 فئران fl / del، Mx-cre التي عولجت بـ Poly (I) · Poly (C) بعمر 8 أسابيع. خلايا BM من معاملة مماثلة RAG-2 fl / del الفئران بمثابة عنصر تحكم. كان العدد الإجمالي لخلايا الطحال المستعادة 4 أسابيع بعد النقل 2.8 × 10 6 في المتلقين المعاد تكوينهم باستخدام BM من Poly (I) · Poly (C) المعالج RAG-2 fl / del ، الفئران Mx-cre و 2.2 × 10 7 في عناصر التحكم. كما هو مبين في الشكل 1 د ، لم تظهر الفئران التي تلقت خلايا BM من الطفرات المستحثة أي إعادة تشكيل يمكن اكتشافها للخلايا البائية ، بينما تم إعادة تكوين عناصر التحكم بالكامل. تم الحصول على نتائج مماثلة باستخدام خلايا BM من فئران متبرعة عمرها 19 أسبوعًا RAG-2 تم تعطيله عند الولادة (البيانات غير معروضة). في كلتا تجربتي إعادة التركيب ، تم اختبار خلايا BM من فئران مانحة بشكل فردي. في جميع الأحوال المستمدة من المانح RAG-2 يمكن الكشف عن الحذف بواسطة PCR في BM والطحال للمستلمين ، مما يشير إلى أن خلايا المتبرع قد تم قبولها من قبل الأخير (البيانات غير معروضة).

انخفاض بطيء واستمرار لاحق للخلايا B الطرفية في الفئران البالغة عند حدوث حصار لتدفق الخلايا البائية من BM.

تم اتباع حركية بقاء الخلايا البائية في الطحال والعقد الليمفاوية و BM في حالة عدم وجود مهاجرين جدد من BM في الفئران التي RAG-2 تم حذفه في سن 8-10 أسابيع. بالمقارنة مع الضوابط ، فإن حجم تجمع الخلايا البائية في الطحال RAG-2 تم تخفيض فئران fl / del، Mx-cre من 67٪ في الأسبوع 2 (في ذلك الوقت اختفت الخلايا غير الناضجة [الشكل 1 ج]) إلى 32٪ في الأسبوع 17 بعد حقن بولي (I) · بولي (سي) و بعد ذلك تم الحفاظ عليه مستقرًا حتى 54 أسبوعًا (الشكل 2 أ). في العقد الليمفاوية ، لم يتم تقليل عدد خلايا B220 + IgD + B خلال الأسبوعين الأولين ، ثم انخفض لاحقًا ، مع انخفاض سريع في عدد الخلايا (من 58 إلى 11٪ من عناصر التحكم) بين الأسبوع 10 والأسبوع 17 بعد إحداثه RAG-2 الحذف (الشكل 2 ب). لم يكن هناك انخفاض إضافي في عدد الخلايا البائية في العقد الليمفاوية بين 17 و 54 أسبوعًا. كما هو مبين في الشكل 2 C ، تم تقليل حجم تجمع الخلايا B الناضجة B عالية المستوى B220 IgM في BM بمقدار النصف مقارنة بعناصر التحكم بعد أسبوعين من حقن Poly (I) · Poly (C) ، ثم انخفض بعد ذلك ببطء خلال فترة المراقبة ، بعمر نصف قدره 156 د. كما هو الحال في الطحال ، كان انخفاض عدد الخلايا البائية خلال الأسبوعين الأولين يرجع أساسًا إلى فقدان خلايا B عالية HSA. مجتمعة ، انخفضت الأرقام الإجمالية للخلايا البائية في الأعضاء الليمفاوية الثانوية للفئران البالغة في غياب تدفق الخلايا البائية من BM خلال أول 17 أسبوعًا وتم الحفاظ عليها لاحقًا لمدة تصل إلى 54 أسبوعًا. في المقابل ، كانت أعداد خلايا IgM + CD5 + B-1a في التجويف البريتوني للطفرات قابلة للمقارنة مع تلك الموجودة في عناصر التحكم (البيانات غير معروضة).

انخفاض خلايا FO B وصيانة خلايا MZ B بعد حذف RAG-2 عند البالغين.

تتميز خلايا MZ B عن إعادة تدوير خلايا FO B بالموقع التشريحي والخصائص المظهرية. وفقًا لمستويات التعبير عن CD21 و CD23 ، قمنا بتقسيم الخلايا B الطحالية إلى خلايا B MZ (CD21 مرتفع CD23) وخلايا B FO (CD21 int CD23 عالية) واتبعنا أرقامها بعد تحريض RAG-2 الحذف في الفئران البالغة. كما هو مبين في الشكل 3 أ ، زادت نسبة خلايا MZ B ضمن مجموعة الخلايا السطحية الموجبة لـ IgM من أقل من 10٪ إلى 17٪ في الأسبوع 2 و -40٪ في الأسبوع 31 بعد RAG-2 الحذف ، حيث كان ثابتًا في الضوابط خلال نفس الفترة الزمنية. من حيث عدد الخلايا ، كان تجمع خلايا MZ B في طحال حيوانات التجربة مشابهًا لتلك الموجودة في عناصر التحكم ومستقرًا على مدى 54 أسبوعًا (الشكل 3 ب). في المقابل ، انخفض عدد خلايا FO B ببطء ، مع نصف عمر محسوب قدره 134 د (الشكل 3 ب) ، وبالتالي في توافق معقول مع تراجع الخلايا البائية المعاد تدويرها في BM (الشكل 2 ج).

عندما يتم إعاقة نمو الخلايا البائية عند الولادة ، يتم الاحتفاظ بأعداد صغيرة من الخلايا البائية ، مع زيادة عدد خلايا B-1 في التجويف البريتوني وخلايا MZ B في الطحال.

إلى أي مدى يمكن للخلايا B غير الناضجة الموجودة في الفئران حديثي الولادة أن تبني حجرة خلية B محيطية في غياب تدفق الخلايا البائية من BM؟ متي RAG-2 تم حذفه عند الأطفال حديثي الولادة عن طريق حقن IFN ، وحافظت الحيوانات على عدد صغير من الخلايا B في الطحال والعقد الليمفاوية على مدى فترات طويلة من الزمن ، ولكن أعداد الخلايا B كانت أقل بكثير من تلك التي تنمو في عناصر التحكم (الشكل 2D والشكل E) . على النقيض من ذلك ، لم يتم إزعاج تطور خلايا B-1a (IgM + CD5 +) في التجويف البريتوني ، واعتبارًا من الأسبوع الثامن بعد حقن IFN ، تم استرداد هذه الخلايا من الحيوانات مرتين إلى ثلاث مرات أكثر من عناصر التحكم (الشكل. 2 و). وبالتالي ، فإن كتلة توليد الخلايا البائية عند الولادة لم تشوش على نمو وتوسع خلايا B-1a ، وهي نتيجة تتماشى مع النتائج السابقة التي تبين أن خلايا B1 هي خلايا ذاتية التجديد 5.

عادة لا تتطور MZ في الفئران حتى 3 أسابيع من عمر 38. جميع خلايا الطحال B في الفئران حديثي الولادة تعبر عن مستويات عالية من HSA ولها نمط ظاهري غير ناضج (البيانات غير معروضة). استحثنا RAG-2 الحذف في الفئران حديثي الولادة عن طريق حقن IFN وسأل عما إذا كانت الخلايا البائية في طحال هذه الحيوانات ستتميز إلى خلايا MZ B في غياب تدفق الخلايا البائية من BM. من المثير للدهشة أن بعض الخلايا البائية اكتسبت النمط الظاهري لخلية MZ B وبعض النمط الظاهري لخلية FO B بالفعل بعد أسبوعين RAG-2 الحذف ، والذي كان أقل وضوحًا في عناصر التحكم المطابقة للعمر (الشكل 3 ج). كانت النسبة المئوية لخلايا MZ B ضمن مجموعة الخلايا السطحية إيجابية IgM 25٪ من الأسبوع 4 حتى الأسبوع 28 بعد RAG-2 الحذف (الشكل 3 ج). من حيث عدد الخلايا ، خلايا MZ B في المستحثة RAG-2زادت الطفرات التي تعاني من نقص طفيف بمرور الوقت ، من 8 × 10 5 في الأسبوع 4 إلى 2 × 10 6 في الأسبوع 28 بعد RAG-2 الحذف (الشكل 3 د). ظلت خلايا FO B النامية في الحيوانات (الشكل 3 ج) ثابتة في الأعداد بمرور الوقت (الشكل 3 د). بصرف النظر عن خلايا MZ و FO B ، يمكن اكتشاف خلايا CD5 + B في طحال الحيوانات ، والتي تبلغ 30-50 ٪ من خلايا IgM + أو CD19 +. بالأرقام المطلقة ، هذا يطابق حجرة خلايا CD5 + B (خلايا B-1a) في طحال عناصر التحكم (البيانات غير معروضة ولكن انظر الشكل 3 ج ، اللوحة السفلية).

كانت الزيادة النسبية في تجمع خلايا MZ B التي شوهدت بواسطة قياس التدفق الخلوي واضحة أيضًا على مستوى الأنسجة. في عمر 8-10 أسابيع ، يمكن ملاحظة زيادة في خلايا MZ B وانخفاض في خلايا FO B في المقاطع النسيجية للطحال في الطفرات ، مقارنةً بالضوابط (الشكل 4).

تكتسب الخلايا البائية المحيطية في الفئران التي تم فيها منع نمو الخلايا البائية عند الولادة نمطًا ظاهريًا نشطًا ولها نشاط تكاثري.

إن تجمعات الخلايا البائية الصغيرة التي يتم الاحتفاظ بها في طحال الحيوانات التي تم فيها منع نمو الخلايا البائية عند الولادة ليست غير عادية فقط فيما يتعلق بميلها للتطور إلى خلايا MZ B. زادت هذه الخلايا أيضًا من حجمها وأظهرت تضخمًا في علامات التنشيط مثل CD25 و CD69 و CD86 و MHC class II عند تحليلها في عمر 8 أسابيع (الشكل 5). أظهرت الخلايا المنشطة ، بغض النظر عما إذا كانت من النمط الظاهري MZ أو FO ، نشاطًا تكاثريًا كبيرًا ، مع 10 ٪ من خلايا MZ B و 7 ٪ من خلايا FO B تضم BrdU بعد فترة وضع العلامات ثلاثية الأبعاد ، مقارنة بـ 16 و 11 ٪ في عناصر التحكم (حيث يوجد تدفق للخلايا البائية المولدة حديثًا من BM الشكل 6 أ). أظهر تحليل الخلايا لمحتوى الحمض النووي أن ما يصل إلى 1٪ من الخلايا كانت في الطور S أو G2 / M من دورة الخلية (الشكل 6 أ). تشير هذه البيانات إلى أن جزءًا كبيرًا من الخلايا البائية المحفوظة في هذه الحيوانات في الطحال والعقد الليمفاوية تخضع للتجديد الذاتي. ومع ذلك ، لا يجوز لجميع الخلايا المشاركة في نشاط التجديد الذاتي هذا ، حيث أدت إدارة BrdU لمدة 3 أسابيع إلى تصنيف ربع الخلايا على الأكثر (البيانات غير معروضة).

كان الوضع مختلفًا تمامًا في الفئران التي تم فيها منع نمو الخلايا البائية في عمر 8 أسابيع. عندما تم تغذية هذه الحيوانات بـ BrdU في مياه الشرب لمدة 3 أيام و 10 أسابيع بعد تطبيق Poly (I) · Poly (C) ، تم تصنيف 1 ٪ فقط من خلايا FO B و 2 ٪ من خلايا MZ B ، مقارنة مع 2 و 3٪ ، على التوالي ، في الضوابط (الشكل 6 ب). وفقًا لمحتوى الحمض النووي ، كان حوالي 1٪ مرة أخرى في الطور S أو G2 / M من دورة الخلية (الشكل 6 ب). من الممكن أن تكتسب الخلايا البائية المتبقية في هذه الحيوانات نشاطًا كاملًا للتجديد الذاتي فقط في وقت لاحق ، عندما تنخفض أعداد الخلايا إلى مستوى مماثل للمستوى الذي شوهد في الحيوانات التي تم فيها منع نمو الخلايا البائية في مرحلة مبكرة. وفقًا لهذا الاحتمال ، متى RAG-2 تم إحداث الحذف في الفئران البالغة ، واكتسبت الخلية B نمطًا ظاهريًا منشطًا مثل ذلك الموضح في الشكل 5 بعد حوالي 4 شهور فقط (البيانات غير معروضة).

يؤدي حذف RAG-2 عند الولادة إلى زيادة مستويات IgM في الدم وعدد خلايا إفراز IgM.

عدد الخلايا البائية في الحيوانات فيها RAG-2 تم حذفه عند الولادة أقل من 10٪ من الضوابط (الشكل 2D والشكل E). ومع ذلك ، في عمر 8 و 17 أسبوعًا ، كانت مستويات الغلوبولين المناعي في المصل في هذه الفئران قريبة من ، وأحيانًا أعلى ، من تلك الموجودة في الضوابط (الشكل 7 أ والشكل ب). لفهم هذه الظاهرة ، استخدمنا ELISPOT لتحديد عدد خلايا إفراز IgM و IgG3 في الطحال و BM للفئران في عمر 8 أسابيع. كما هو مبين في الشكل 7 ج ، كان العدد الإجمالي لخلايا إفراز IgM أكبر بثلاثة إلى أربعة أضعاف في الخلايا المستحثة. RAG-2 المسوخات مقارنة بالضوابط ، كما أن الحيوانات كانت تؤوي أعدادًا كبيرة من خلايا إفراز IgG3. قد تُشتق الخلايا التي تفرز الجسم المضاد بشكل كبير من خلايا B-1 الموجودة في هذه الحيوانات بأعداد طبيعية ومن المعروف أنها تساهم بشكل كبير في إنتاج IgM 39.


تراوح أقصى إزاحة للخلايا المتجانسة التي صممها الأشخاص من 2 إلى 4 أمتار ، وهو ما يمكن مقارنته بالأحجام المبلغ عنها للفجوات العملاقة (Tripathi 1972)

تراوح أقصى إزاحة للخلايا المتجانسة التي صممها الأشخاص من 2 إلى 4 أمتار ، وهو ما يمكن مقارنته بالأحجام المبلغ عنها للفجوات العملاقة (Tripathi 1972). تمتلك ارتباطات كبيرة مع طبقاتها التحتية من محيطها. يضع هذا حدودًا لمقاومة الحركة التي يمكن أن يولدها الطلاء ، والتي تشمل الآثار المتعلقة بالموقع الإلكتروني حيث يمكن إنشاء جميع مقاومة الحركة تقريبًا في العين الصحية والمائية. رسم تخطيطي للجزء الأمامي من العين يعرض مسار حركة الضحك المائي في تضخم من موضع القزحية القرنية (في نقل صورة مجهرية إلكترونية للخلايا البطانية التي تطور بنية الجدار الداخلي للضحك المائي SC عبر البطانة عبر مسام الجلد للدخول إلى تجويف SC.V ، فجوات كبيرة JCT ، الخلايا الضامة المجاورة (Overby et al. 2014) خلايا قناة Schlemms تحت رحمة alpha-Amanitin لبيئة ميكانيكية حيوية حصرية نسبيًا. على عكس الخلايا البطانية الوعائية المعرضة لتدرج ضغط قمي إلى قاعدي يدعمه & # 8217s من خلال الغشاء القاعدي الخاص بها ، تكون خلايا SC تحت رحمة تدرج ضغط من القاعدة إلى القمة يدفع الخلايا من الغشاء القاعدي المساعد. ونتيجة لذلك ، تمر خلايا SC بتشوهات كبيرة وتخلق هياكل تُعرف باسم فجوات كبيرة (Brilakis و Johnson 2001 Grierson and Lee 1977) يعتقد أن هذه التشوهات تؤدي إلى تطور المسام في هذه الخلايا ، والتي من خلالها يتحرك الضحك المائي (Ethier et al. 1998 جونسون وآخرون. alpha-Amanitin 1990). نظرًا لاستمرار ملاحظة كثافة المسام لتصبح منخفضة ألفا-أمانيتين في العين الزرق (Allingham et al. 1992 Johnson et al. هنا ، وصفنا RAC2 استخدام المجهر الإلكتروني لمسح الوجه المتسلسل (SBSEM) ونمذجة المكونات المحدودة (FEM) إلى جانب قياسات مجهر الدفع الذري (AFM) من معامل خلايا SC (Vargas-Pinto et al. 2013) لوصف عواقب هندسة الخلية ، وضيق الخلية ، بالإضافة إلى مساهمة قشرة الخلية في التشوه الناتج عن الضغط لخلايا SC ، نحسب أقصى انخفاض للضغط يمكن أن تدعمه هذه الخلايا أيضًا. من خلال إنشاء هذا الاتجاه العلوي ، يمكننا تحديد ما إذا كان من الممكن افتراض أن بطانة هيكل الجدار الداخلي لـ SC يمكن افتراضها إلى حد ما لمساعدة جزء صغير كبير من انخفاض الضغط الكامل على مسار التدفق المنتظم. 2 الإستراتيجيات 2.1 تصوير خلايا SC تم تلقي عينين متبرعين بشريين بدون تاريخ معروف لأمراض العيون (عمر 69 و 70 عامًا) من تبادل دراسة الأمراض على مستوى الدولة (فيلادلفيا ، بنسلفانيا) في غضون 24 ساعة بعد الوفاة. تم ضبط عينات الأنسجة الشعاعية والأمامية للشبكة التربيقية وتشذيبها باستخدام 2.5 ٪ جلوتارالدهيد و 4 ٪ بارافورمالدهيد داخل محلول كاكوديلات الصوديوم 0.1-M. تم تلطيخ أنسجة المجموعة بحموضة التانيك وملطخة بالأوزميوم-فيروسيانيد ، مصحوبة بمعالجة رباعي الكربوهيدرات ، وملطخة إضافية برباعي أكسيد الأوزميوم المائي بعد ذلك. تم تحضين الخلايا في أسيتات اليورانيل المائي المشبع بعد ذلك ، مصحوبة بأسبارتاتي رائد أعمال والتونس (Deerinck et al. 2010). ثالثًا ، تم تجفيف الأنسجة وترصيعها في Epon. SBSEM picture data sets had been obtained at Renovo Neural Inc. (Cleveland, OH). An example image is provided in Online Source 1. The cells blocks were installed, analyzed, and sectioned inside a Zeiss Sigma VP checking electron microscope built with a Gatan 3View in-chamber ultramicrotome stage with low-kV backscattered electron detectors optimized for 3View systems. The internal wall structure endothelium of SC in each test stop was initially determined, and the parts of curiosity were chosen to add small part of lumen of SC, internal wall structure endothelium of SC, as well as the root JCT. The first sample block was sectioned along the much longer axis of SC longitudinally. Some 500 EM pictures inside a field size of 204.80 61.40 m were acquired at 2.25 kV with an answer of 10 nm per pixel and 100 nm per cut. Five internal wall structure endothelial cells had been captured out of this data arranged. However, because of the great cell size, the limited field size could just catch one endothelial cell (SC04), as the other four cells were out of field partially. To make sure catch of the entire amount of SC cells while preserving very similar field quality and size, cross areas along the shorter axis of SC had been cut in the next sample stop. Each image attained from this stop demonstrated a transverse watch from the cell. Some 1001 EM pictures within a field size of 53.30 31.98 m.


Raw NGS sequencing data analyzed with a custom analysis pipeline, available from the docker hub repository at hub.docker.com under kamhonhoi/iganalysis. Principal Component Analysis performed using the ‘princomp’ function and Repertoire Similarity Index, implemented using the ‘sdists’ function in the package ‘cba’ in R version 3.5.0.

Schroeder, H. W. Jr. & Cavacini, L. Structure and function of immunoglobulins. كلين الحساسية. إمونول. 125, S41–S52 (2010).

Cobb, R. M., Oestreich, K. J., Osipovich, O. A. & Oltz, E. M. Accessibility control of V(D)J recombination. حال. إمونول. 91, 45–109 (2006).

Bassing, C. H., Swat, W. & Alt, F. W. The mechanism and regulation of chromosomal V(D)J recombination. زنزانة 109(Suppl), S45–S55 (2002).

Rajewsky, K. Clonal selection and learning in the antibody system. طبيعة سجية 381, 751–758 (1996).

Nemazee, D. Mechanisms of central tolerance for B cells. نات. القس إمونول. 17, 281–294 (2017).

Zemlin, M. et al. Expressed murine and human CDR-H3 intervals of equal length exhibit distinct repertoires that differ in their amino acid composition and predicted range of structures. جيه مول. بيول. 334, 733–749 (2003).

Schroeder, H. W. Jr. Similarity and divergence in the development and expression of the mouse and human antibody repertoires. ديف. شركات إمونول. 30, 119–135 (2006).

Bagnara, D. et al. A reassessment of IgM memory subsets in humans. J. إمونول. 195, 3716–3724 (2015).

Wardemann, H. et al. Predominant autoantibody production by early human B cell precursors. علم 301, 1374–1377 (2003).

Wu, Y. C. et al. High-throughput immunoglobulin repertoire analysis distinguishes between human IgM memory and switched memory B-cell populations. دم 116, 1070–1078 (2010).

Roskin, K. M. et al. IgH sequences in common variable immune deficiency reveal altered B cell development and selection. علوم. ترجمة. ميد. 7, 302ra135 (2015).

Doorenspleet, M. E. et al. Rheumatoid arthritis synovial tissue harbours dominant B-cell and plasma-cell clones associated with autoreactivity. آن. الرومات. ديس. 73, 756–762 (2014).

Bashford-Rogers, R. J. M., Smith, K. G. C. & Thomas, D. C. Antibody repertoire analysis in polygenic autoimmune diseases. علم المناعة 155, 3–17 (2018).

DeKosky, B. J. et al. Large-scale sequence and structural comparisons of human naive and antigen-experienced antibody repertoires. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 113, E2636–E2645 (2016).

Ivanov, I. I. et al. Development of the expressed Ig CDR-H3 repertoire is marked by focusing of constraints in length, amino acid use, and charge that are first established in early B cell progenitors. J. إمونول. 174, 7773–7780 (2005).

Larimore, K., McCormick, M. W., Robins, H. S. & Greenberg, P. D. Shaping of human germline IgH repertoires revealed by deep sequencing. J. إمونول. 189, 3221–3230 (2012).

Elhanati, Y. et al. Inferring processes underlying B-cell repertoire diversity. فيلوس. عبر. R. Soc. لوند. ب بيول. علوم. 370, 20140243, https://doi.org/10.1098/rstb.2014.0243 (2015).

Miqueu, P. et al. Statistical analysis of CDR3 length distributions for the assessment of T and B cell repertoire biases. مول. إمونول. 44, 1057–1064 (2007).

Marcou, Q., Mora, T. & Walczak, A. M. High-throughput immune repertoire analysis with IGoR. نات. كومون. 9, 561 (2018).

Briney, B., Inderbitzin, A., Joyce, C. & Burton, D. R. Commonality despite exceptional diversity in the baseline human antibody repertoire. طبيعة سجية 566, 393–397 (2019).

Goldstein, L. D. et al. Massively parallel single-cell B-cell receptor sequencing enables rapid discovery of diverse antigen-reactive antibodies. كومون. بيول. 2, 304 (2019).

Laserson, U. et al. High-resolution antibody dynamics of vaccine-induced immune responses. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 111, 4928–4933 (2014).

DeKosky, B. J. et al. In-depth determination and analysis of the human paired heavy- and light-chain antibody repertoire. نات. ميد. 21, 86–91 (2015).

Busse, C. Dynamics of the human antibody repertoire after influenza vaccination. NCBI BioProject Database, https://www.ncbi.nlm.nih.gov/bioproject/PRJNA349143 (2016).

DeWitt, W. S. et al. A public database of memory and naive B-cell receptor sequences. بلوس واحد 11, e0160853 (2016).

Lefranc, M. P. IMGT, the international ImMunoGeneTics database: a high-quality information system for comparative immunogenetics and immunology. ديف. شركات إمونول. 26, 697–705 (2002).

Greiff, V. et al. Systems analysis reveals high genetic and antigen-driven predetermination of antibody repertoires throughout B cell development. مندوب الخلية. 19, 1467–1478 (2017).

Matsutani, T. et al. Comparison of CDR3 length among thymocyte subpopulations: impacts of MHC and BV segment on the CDR3 shortening. مول. إمونول. 44, 2378–2387 (2007).

Miho, E., Roskar, R., Greiff, V. & Reddy, S. T. Large-scale network analysis reveals the sequence space architecture of antibody repertoires. نات. كومون. 10, 1321 (2019).

Boyd, S. D. et al. Individual variation in the germline Ig gene repertoire inferred from variable region gene rearrangements. J. إمونول. 184, 6986–6992 (2010).

Kidd, M. J. et al. The inference of phased haplotypes for the immunoglobulin H chain V region gene loci by analysis of VDJ gene rearrangements. J. إمونول. 188, 1333–1340 (2012).

Gidoni, M. et al. Mosaic deletion patterns of the human antibody heavy chain gene locus shown by Bayesian haplotyping. نات. كومون. 10, 628 (2019).

Shirai, H., Kidera, A. & Nakamura, H. H3-rules: identification of CDR-H3 structures in antibodies. FEBS ليت. 455, 188–197 (1999).

North, B., Lehmann, A. & Dunbrack, R. L. Jr. A new clustering of antibody CDR loop conformations. جيه مول. بيول. 406, 228–256 (2011).

Weitzner, B. D., Dunbrack, R. L. Jr. & Gray, J. J. The origin of CDR H3 structural diversity. بنية 23, 302–311 (2015).

Vander Heiden, J. A. et al. Dysregulation of B cell repertoire formation in Myasthenia Gravis patients revealed through deep sequencing. J. إمونول. 198, 1460–1473 (2017).

Jain, T. et al. Biophysical properties of the clinical-stage antibody landscape. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 114, 944–949 (2017).

Collis, A. V., Brouwer, A. P. & Martin, A. C. Analysis of the antigen combining site: correlations between length and sequence composition of the hypervariable loops and the nature of the antigen. جيه مول. بيول. 325, 337–354 (2003).

Breden, F. et al. Comparison of antibody repertoires produced by HIV-1 infection, other chronic and acute infections, and systemic autoimmune disease. بلوس واحد 6, e16857 (2011).

Magoc, T. & Salzberg, S. L. FLASH: fast length adjustment of short reads to improve genome assemblies. المعلوماتية الحيوية 27, 2957–2963 (2011).

Chen, Y. et al. Barcoded sequencing workflow for high throughput digitization of hybridoma antibody variable domain sequences. J. إمونول. أساليب 455, 88–94 (2018).

Ye, J., Ma, N., Madden, T. L. & Ostell, J. M. IgBLAST: an immunoglobulin variable domain sequence analysis tool. الدقة الأحماض النووية. 41, W34–W40 (2013).

Sankar, K., Hoi, K. H., Jr. & Hotzel, I. Dynamics of heavy chain junctional length biases in antibody repertoires. Dryad Database, https://doi.org/10.5061/dryad.cjsxksn5062x (2020).


مقدمة

In mouse and man, B cells are continuously generated from B cell progenitors over lifetime, with the fetal liver and, from around birth on, the bone marrow (BM) as the main sites where this process takes place. The immature B cells generated in the BM emigrate into the peripheral immune system and give rise to a heterogeneous population of peripheral B cells including naive, memory and plasma cells 1. In terms of their anatomical location and surface markers, the B cell population in the periphery consists of recirculating IgM low IgD high CD21 int CD23 high cells located in follicles in spleen and lymph nodes, and IgM high IgD low CD21 high CD23 low non-recirculating cells enriched mainly in the marginal zone (MZ) of the spleen 2,3. Follicular (FO) B cells in the spleen account for 80–90% and MZ B cells for 5–10% of the splenic B cells in an adult mouse 4. Another B cell subset, consisting of the so-called B-1 cells, has self-renewing capacity and predominates in the peritoneal and pleural cavities 5. Recent data on the function of MZ B cells 6,7,8 and B-1 cells 9,10 suggest that these cells provide a first line of defense against antigens in the blood, and in the peritoneal and pleural cavities, respectively. FO B cells are involved in T cell–dependent antibody responses, in which memory and plasma cells are generated 7.

About 1–2 × 10 7 immature B cells are generated daily in the adult murine BM 11. Of these, only 3% enter the pool of mature B cells of the various subsets 12. Peripheral B cell pools represent dynamic, yet stable compartments where the input contributed by BM immigrants and antigen driven cell proliferation is balanced by apoptosis and terminal differentiation 13.

For an understanding of this homeostatic control it is of critical importance to determine the life spans of B cells of various subsets under physiological conditions. It is therefore not surprising that B cell life spans have been the subject of many investigations in the past. However, while it is generally agreed that newly generated immature B cells in adult mice have life spans of ∼3-4 d 12,14, the life spans of mature B cells are still controversial. Experiments based on (a) adoptive transfer of LPS-reactive B cells into LPS-nonreactive recipient mice 15 (b) the ablation of cycling B cell precursors with cytotoxic drugs which selectively kill cycling cells 16,17 and (c) induction of BM aplasia using a radioactive strontium isotope, 89 S 18 support the hypothesis that most mature B cells have a life span of just a few days 13. In contrast, experiments in which B cell development was blocked by anti–IL-7 19, or anti–IL-7 receptor antibodies 20 or cells were labeled by [ 3 H]thymidine 21,22,23 or bromo deoxyuridine (BrdU) in vivo 24,25,26 lead to the conclusion that the majority of splenic B cells can persist for several weeks or months.

To further clarify this matter and to extend the analysis to the various subsets of mature B cells, we have now generated a transgenic mouse strain in which B cell development can be blocked permanently at any stage of development under quasi-physiological conditions. To achieve this goal we made use of the fact that both B and T cell development critically depend on the somatic assembly of Ig or T cell receptor variable region gene segments, called V, D, and J, by a process known as V(D)J recombination 27. V(D)J recombination is mediated by the products of the recombination-activating genes RAG-1 و RAG-2 28. Consequently, in RAG-1– أو RAG-2–deficient mice B and T cell development are blocked at an early progenitor stage 29,30. Induced inactivation of RAG-1 أو RAG-2 in B and T cell progenitors in the BM can thus be expected to lead to a block in B and T cell generation. Using conditional gene targeting 31, we established a transgenic mouse strain in which RAG-2 can be inducibly and efficiently inactivated whenever desired. In the present paper, we describe this experimental system and use it to study the maintenance and differentiation of the various peripheral B cell subsets in intact, healthy animals, in the absence of B cell influx from the BM, i.e., a situation in which B cell life spans should be maximized.


Materials And Methods

Isolation of Thymocytes.

Methods for maintenance of SCID-hu mice and harvest of thymocytes from SCID-hu Thy/Liv organs were identical to those previously published 17. In some cases, SCID-hu Thy/Liv organs were harvested and placed in RPMI 1640 media (Life Technologies) supplemented with 10% FCS (Summit Biotechnology) and transported overnight at 4°C before harvest of thymocytes. After isolation, thymocytes were resuspended in PBS supplemented with 2% FCS and kept on ice before staining with mAbs for flow cytometric analysis or cell sorting. All procedures and practices were approved by the University of California, San Francisco Committee on Human Research (CHR) or Committee on Animal Research.

Isolation of PBMCs.

Whole blood samples from human subjects were collected by phlebotomy into EDTA collection tubes (Becton Dickinson). PBMCs were isolated from whole blood by density–gradient centrifugation (Life Technologies). PBMCs were washed twice with PBS before resuspension in PBS supplemented with 2% FCS before staining with mAbs for flow cytometry or cell sorting.

Stimulation of Cord Blood Cells In Vitro.

Human umbilical cord blood cells were obtained (with CHR approval) from healthy delivery specimens and placed in heparinized collection tubes (Becton Dickinson) under sterile conditions. Cord blood mononuclear cells (CBMCs) were isolated as described above for whole blood specimens and resuspended at a concentration of 2 × 10 6 cells/ml in RPMI 1640 supplemented with 10% human AB serum (Ultraserum Gemini Bio-Products). CBMCs were then cultured (at 37°C in 5% CO2) for 48, 72, or 96 h or 9 d (time points encompassed in two different experiments) and stimulated with 5 μg/ml of PHA (Sigma Chemical Co.) and 10 U/ml purified IL-2 (Boehringer Mannheim). The supplemented medium was changed every 3 d. Cell culture controls did not receive PHA or IL-2 stimulation but were cultured for 72 h in the same medium. Aliquots of the cell cultures at different time points were analyzed by flow cytometry for the expression of the cell surface markers CD45RA and CD62L.

Immunophenotypic Analysis and Cell Sorting by Flow Cytometry.

PBMCs, thymocytes from SCID-hu mice, or CBMCs were stained with fluorescent-conjugated mABs specific for cell surface markers at a concentration of 10 7 cells/ml at 4°C for 30 min. After staining, cells were washed with PBS supplemented with 2% FCS and sorted on either a FACStar™ or FACS Vantage™ cell sorter (both from Becton Dickinson). The cells were stained with one of the following antibody combinations: (a) anti-CD8–FITC and anti-CD4–PE (Becton Dickinson) (b) anti-CD45RA–FITC or anti-CD45RO–FITC (Immunotech), anti-CD62L–PE (Becton Dickinson), and anti-CD4–ECD (Coulter Immunology) (c) anti-CD62L–FITC, anti-CD45RA–PE (PharMingen), and anti-CD4–tricolor or anti-CD4–allophycocyanin (Caltag Labs., Inc.). Sort purities were checked after each sort and were ≥97%. For analysis of cord blood CD45RA and CD62L expression, CBMCs were stained with anti-CD45RA–FITC (Immunotech) and anti-62L–PE (Becton Dickinson) and analyzed using a FACScan™ cytometer and CELLQuest™ software (both from Becton Dickinson).

Detection of TCR-β Rearrangement Deletion Circles.

Total DNA from distinct cell populations was extracted and purified via a standard protocol 18 before spectrophotometric quantitation at 260 and 280 nm. The freshly isolated DNA was stored at 4°C for further processing. Thermal cycling was performed for 30 cycles (1 min at 94°C, 1.5 min at 65°C, and 1.5 min at 72°C) for each round of a seminested PCR protocol designed to detect VβDβ-specific deletion circles (DCs) generated by TCR-β recombination. All first and second round primers were generated to fully hybridize with noncoding regions of the TCR-β locus 19 located next to the recombination signal sequences (RSS available from EMBL/GenBank/DDBJ under accession numbers U66059, U66060, and U66061 see Table). Four PCR replicates were performed on each total DNA serial dilution to ensure a precise readout for each experiment. Concentrations of total DNA were adjusted so that a constant volume of 3 μl was added to each 50-μl PCR reaction (200 μM dNTPs, 1× PCR buffer [Boehringer Mannheim], 100 ng of each primer, and 2 U of Taq polymerase [Boehringer Mannheim]). From the first PCR amplification, 3 μl of the first PCR product was used as template for the second (seminested) PCR reaction (under the same conditions) using the “Circle” primer and the DC-Dβ1 primer.

Quantitative Analysis of Endpoint Dilutions.

Second round PCR products were visualized with ethidium bromide on 1.25% agarose gels and digitally photographed. Individual amplifications were scored as positive or negative by two observers. The highest dilution returning a positive amplification was taken as the endpoint for each dilution series. Dilution series with more than two “skipped” wells (i.e, a failed amplification followed by a successful amplification at higher dilution) were omitted from the analysis. The abundance of DCs was estimated by the Reed-Muench method 20,21. This method uses information from replicate dilution series to estimate an endpoint (measured in terms of nanograms of input DNA) in which 50% of samples were positive for DCs (the 50% DC endpoint). The DC frequency (DCF) was arbitrarily defined as the reciprocal of the 50% DC endpoint × 100. Alternatively, the seminested PCR data were analyzed by a maximum likelihood estimated method of dilution endpoint with a parametric method 22. Unlike the Reed-Muench method, this method returns an estimate of goodness of fit of the data to the estimated endpoint. Endpoints estimated by the two methods were highly correlated (ص 2 = 0.929), and the choice of method did not alter the conclusions drawn from the data. The degree of inter- and intraassay variation was assessed by performing two independent experiments on two different samples from the same individuals (ن = 3) and ranged on the order of two- to threefold (data not shown).


أساليب

RAG and HMGB1 protein purification

Truncated and full-length forms of RAG1 (residues 384–1040 and 1–1040, respectively) and RAG2 (residues 1–387 and 1–517, respectively) containing an amino-terminal maltose binding protein fusion partner (cMR1, FLMR1, cMR2, and FLMR2, respectively) were coexpressed in 293 cells and purified by amylose affinity chromatography according to published procedures [30]. Full-length, truncated, or mutant forms of amino-terminal polyhistidine-tagged HMGB1 were expressed in بكتريا قولونية and purified as described elsewhere [26].

DNA substrates

Oligonucleotide substrates containing a 12-RSS or 23-RSS cRSS labelled at the 5' end of the top strand were prepared as described elsewhere [24, 30]. A substrate containing the bps6197 sequence was similarly prepared from the oligonucleotide 5'-TCCCCGAAAAGTGCCACCTGACG TCTAAGAAACC ATTATTATCATGACATTAACC TATAAA-3' and its complement (positions equivalent to the 23-RSS heptamer and nonamer motifs are underlined). Derivatives of this substrate containing mutations at positions indicated in the text were also prepared. Unlabeled DNA substrates containing consensus 12-RSS, 23-RSS, Hox11 or non-specific DNA sequences (DAR81/82) were prepared from oligonucleotides described previously [11, 24].

The plasmid V(D)J recombination substrates pGG49, its derivatives containing Ttg-1 or Hox11 cRSS sequences, and pJH299 have been described elsewhere [4, 10]. Derivatives of pGG49 lacking the 12-RSS or 23-RSS were generated by سال أنا أو BamH I digestion, respectively. Variants of pGG49 and pJH299 containing the wild-type or mutant bps6197 sequences discussed in the text were generated according to procedures described in Additional File 3: Supplementary Materials and Methods. Long DNA fragments (

650 bp) radiolabeled at the 5' end of the top strand containing the RSS, cRSS, and/or wild-type or mutant bps6197 sequences present in pGG49 and its derivatives were generated by PCR using radiolabeled primer 6000F (5'-TATTGTCCTCATGAGCGGATAC-3') and unlabeled primer 6624R (5'-GAACGGTGGTATATCCAGTG-3'). PCR samples (100 μl final volume) containing plasmid template DNA (70 ng) and primers (20 pmol each) were subjected to initial denaturation at 95°C for 4 min, followed by 30 cycles of amplification (95°C for 45 sec, 56°C for 30 sec, and 72°C for 60 sec) and a final extension (72°C for 4 min). PCR products were isolated using a QIAquick PCR purification kit (Qiagen), eluted in 50 μl buffer EB (10 mM Tris, pH 8.0), fractionated on a vertical agarose gel (1.4%) at 150V for 1.5 h, and gel-isolated DNA purified using a QIAquick Gel Extraction Kit (Qiagen).

في المختبر RAG cleavage and binding assays

RAG-mediated cleavage of oligonucleotide substrates, PCR-generated long DNA fragments, or plasmid DNA was analyzed using an في المختبر cleavage assay described previously [24]. Unless otherwise noted, basic في المختبر cleavage reactions (10 μL) contained cMR1/cMR2 (


شاهد الفيديو: Immunology - Antibody Somatic VDJ Recombination I (قد 2022).