معلومة

ب 1. Carboxypeptidase - علم الأحياء

ب 1. Carboxypeptidase - علم الأحياء



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

ترتبط ركيزة الببتيد في الموقع النشط لإنزيم carboxypeptidase. تُظهر هياكل الأشعة السينية للإنزيم مع وبدون مثبط تنافسي تغيرًا كبيرًا في التكوين في الموقع النشط عندما يرتبط المانع أو الركيزة. بدون مانع ، تحتل العديد من المياه الموقع النشط. عندما يتم ربط المثبط والركيزة المفترضة ، يترك الماء (وهو مفضل من الناحية الحتمية) ، ويتأرجح Tyr 248 بالقرب من سطح البروتين في حالة عدم وجود جزيء في الموقع النشط للتفاعل مع مجموعة الكربوكسيل للجزيء المرتبط ، مسافة الحركة تساوي حوالي 1/4 قطر البروتين. هذا يغلق بشكل فعال الموقع النشط ويطرد الماء. A ( ce {Zn ^ {2 +}} ) أيون موجود في الموقع النشط. إنه مرتبط بـ His 69 ، و 196 ، و Glu 72 ، وأخيراً جزيء الماء كالرابط الرابع. جيب كاره للماء الذي يتفاعل مع المجموعة الفينولية للطبقة التحتية يفسر خصوصية البروتين.

في الآلية التحفيزية ، يساعد ( ce {Zn ^ {2 +}} ) على استقطاب رابطة الأميد القابلة للتغير ، بينما يعمل Glu 270 كقاعدة عامة ، والذي يعمل جنبًا إلى جنب مع ( ce {Zn ^ {2+} } ) يساعد على تعزيز تفكك البروتون من الماء المربوط ، مما يجعله محبًا للنواة بشكل أفضل. يهاجم الماء الكربون المحب للكهرباء للرابطة اللاطئة ، حيث يعمل Glu 270 كمحفز أساسي عام. ثم ينهار الوسيط رباعي السطوح ، ويطرد مجموعة الأمين الخارجة ، التي تلتقط بروتونًا من Glu 270 ، والذي يعمل الآن كمحفز حمضي عام. اعتاد الناس على الاعتقاد بأن Tyr 248 كان بمثابة حمض عام ، لكن الطفرات أظهرت أنه يمكن استبدال Tyr 248 بـ Phe 248 دون تأثير كبير على معدل التفاعل.

جمول: تم تحديث Carboxypeptidase A Jmol14 (جافا) | JSMol (HTML5)


Carboxypeptidase B1 (نسيج)

& ltp> توفر درجة التعليق التوضيحي مقياسًا إرشاديًا لمحتوى التعليق التوضيحي لإدخال أو بروتيوم UniProtKB. هذه الدرجة & ltstrong> لا يمكن & lt / strong> استخدامها كمقياس لدقة التعليق التوضيحي حيث لا يمكننا تحديد "التعليق التوضيحي الصحيح" لأي بروتين معين. & ltp> & lta href = '/ help / annotation_score' target = '_ top'> أكثر. & lt / a> & lt / p> - دليل تجريبي على مستوى البروتين i & ltp> يشير هذا إلى نوع الدليل الذي يدعم وجود البروتين. لاحظ أن دليل "وجود البروتين" لا يعطي معلومات عن دقة أو صحة التسلسل (التسلسلات) المعروضة. & ltp> & lta href = '/ help / protein_existance' target = '_ top'> المزيد. & lt / a> & lt / p>

حدد قسم على اليسار لرؤية المحتوى.


& ltp> يوفر هذا القسم أي معلومات مفيدة حول البروتين ، ومعظمها معلومات بيولوجية. & ltp> & lta href = '/ help / function_section' target = '_ top'> المزيد. & lt / a> & lt / p> الوظيفة i

& ltp> يوفر هذا القسم الفرعي من قسم "الوظيفة" معلومات ذات صلة بالعوامل المساعدة. العامل المساعد هو أي مادة غير بروتينية مطلوبة لكي يكون البروتين نشطًا محفزًا. بعض العوامل المساعدة غير عضوية ، مثل ذرات المعادن والزنك والحديد والنحاس في حالات الأكسدة المختلفة. البعض الآخر ، مثل معظم الفيتامينات ، عضوية. & ltp> & lta href = '/ help / cofactor' target = '_ top'> المزيد. & lt / a> & lt / p> العامل المساعد ط

& # xd & ltp> المعلومات التي تم إنشاؤها بواسطة نظام التعليقات التوضيحية التلقائي UniProtKB ، بدون التحقق اليدوي. & lt / p> & # xd & # xd & ltp> & lta href = "/ manual / Evidences # ECO: 0000256"> المزيد. & lt / a> & lt / p> & # xd تأكيد تلقائي وفقًا للقواعد i

& ltp> The & lta href = "http://www.geneontology.org/"> مشروع علم الوجود الجيني (GO) & lt / a> يوفر مجموعة من المفردات الهرمية المحكومة مقسمة إلى 3 فئات: & ltp> & lta href = '/ help / gene_ontology 'target =' _ top '> المزيد. & lt / a> & lt / p> GO - الوظيفة الجزيئية i

    المصدر: MGI المصدر: GO_Central & # xd & ltp> يُستدل عليه من الجانب البيولوجي للسلف & lt / p> & # xd & # xd & ltp> نوع من دليل علم الوراثة حيث يتم الاستدلال على جانب من سليل من خلال توصيف جانب من جوانب السلف gene. & lt / p> & # xd & # xd & ltp> مزيد من المعلومات في & lta href = "http://geneontology.org/page/guide-go-evidence-codes#iba"> دليل كود دليل GO & lt / a> & lt / p> & # xd يُستدل عليه من الجانب البيولوجي للسلف i

      GO - العملية البيولوجية i

      & ltp> الكلمات الرئيسية لـ UniProtKB تشكل & lta href = "http://www.uniprot.org/keywords"> مفردات مضبوطة & lt / a> ببنية هرمية. تلخص الكلمات الرئيسية محتوى إدخال UniProtKB وتسهل البحث عن البروتينات المهمة. & ltp> & lta href = '/ help / keywords' target = '_ top'> المزيد. & lt / a> & lt / p> الكلمات الرئيسية i

      & # xd & ltp> المعلومات التي تم استيرادها من قاعدة بيانات أخرى باستخدام الإجراءات التلقائية. & lt / p> & # xd & # xd & ltp> & lta href = "/ manual / Evidences # ECO: 0000313"> المزيد. & lt / a> & lt / p> & # xd التأكيد التلقائي المستنتج من إدخالات قاعدة البيانات i

      التأكيد التلقائي وفقًا للقواعد i

      التأكيد التلقائي وفقًا للقواعد i

      التأكيد التلقائي وفقًا للقواعد i

      التأكيد التلقائي وفقًا للقواعد i

      قواعد بيانات الإنزيم والمسار

      Reactome - قاعدة معرفية للمسارات والعمليات البيولوجية

      قواعد بيانات عائلة / مجموعة البروتين


      المواد والأساليب

      تصميم التمهيدي.

      بسبب ال أ. ستيفنسي لم يتم تسلسل الجينوم بعد ، ووفقًا لتوصيات Scotto-Lavino et al. (23) للتضخيم السريع 3 & # x02032 لنهايات (كدنا) (RACE) للأنواع غير المتسلسلة ، كبب -1 تسلسل مرنا من نواقل البعوض المختلفة ، مثل ألف غامبيا (رقم انضمام GenBank. <"type": "entrez-nucleotide"، "attrs": <"text": "AY545988"، "term_id": "46487999"، "term_text": "AY545988" >> AY545988) ، كوليكس بيبيينز (رقم انضمام GenBank. <"type": "entrez-nucleotide" ، "attrs": <"text": "XM_001856118" ، "term_id": "170049442" ، "term_text": "XM_001856118" >> XM_001856118) ، و الزاعجة المصرية (رقم انضمام GenBank. <"type": "entrez-nucleotide"، "attrs": <"text": "AY590494"، "term_id": "47679576"، "term_text": "AY590494" >> AY590494) ، كانت محاذاة بواسطة برنامج MEGA4. بعد التحليل ، تم اختيار خمس مناطق لتصميم البادئات الخاصة بالجينات وتم تصميم الاشعال AnSt314 و AnSt615 و AnSt808 و R1 و R2 (الجدول 1).

      الجدول 1

      قائمة البادئات التي تم تصميمها واستخدامها في هذه الدراسة أ

      اسم التمهيديتسلسل
      رابط5 & ​​# x02032- GAGATTTGAATCTTGCTTCTGGGCCCTCTATTGTCATTGTCTTTTTTTTTTTTTTTTT -3 & # x02032
      الخارجي5 & ​​# x02032- GAGATTTGAATCTTGCTTCTG -3 & # x02032
      داخلي5 & ​​# x02032- GGCCCTCTATTGTCATTGTC -3 & # x02032
      AnSt3145 & ​​# x02032- CAGGAGTTGCTGAATCGAG -3 & # x02032
      AnSt6155 & ​​# x02032- GGTATTCATGCCAGAGAATG -3 & # x02032
      AnSt8085 & ​​# x02032- CAACTTCCCCTTCCAGTG -3 & # x02032
      R15 & ​​# x02032- GTCAGCTCGAGCGTGTAC -3 & # x02032
      R25 & ​​# x02032- GGTTGATTATTGCCACTG -3 & # x02032
      AnSt2235 & ​​# x02032- CCGTAACTTCCCTTTCATG -3 & # x02032
      AnSt2975 & ​​# x02032- CCGAGAACGAAACCAAAG -3 & # x02032
      AnSt4085 & ​​# x02032- أكجاكتككتجكاكجكاك -3 & # x02032
      AnSt4405 & ​​# x02032- CTGCAGCGTTTGGGTGAG -3 & # x02032
      R4275 & ​​# x02032- TGCAGATCTTCCGCGTTC -3 & # x02032
      R3285 & ​​# x02032- CGCCTTGTACTGGTCCATC -3 & # x02032
      R745 & ​​# x02032- AGCTGTTCCGCATAGTCTTC -3 & # x02032
      As.RT.F5 & ​​# x02032- GAGGATGTACAGGAGTTGCTGAAC -3 & # x02032
      As.RT.R5 & ​​# x02032- CGTCCAGAAGTGTTCAAAGTTCAC -3 & # x02032
      S7F5 & ​​# x02032- TGGAAATGAACTCGGATCTGAAG -3 & # x02032
      S7R5 & ​​# x02032- ACCGGCACGTAGATGATGATC -3 & # x02032
      ClCPBAs-F5 & ​​# x02032- GCTCTC GGATCC GGTTCCTATCATGAATTGAAGTG -3 & # x02032
      ClCPBAs-R5 & ​​# x02032- CTCAGG CTCGAG CGGCGTCAACGACAACGT -3 & # x02032

      في الخطوة التالية ، بخصوص الجزء الأوسط من ملف cpbAs1 تسلسل mRNA (رقم انضمام GenBank. <"type": "entrez-nucleotide" ، "attrs": <"text": "GU818728.1" ، "term_id": "290491359" ، "term_text": "GU818728.1" >> GU818728.1) ، 3 & # x02032 RACE (AnSt408 ، AnSt440 ، AnSt297 ، و AnSt223) و 5 & # x02032 RACE (R427 ، R328 ، R74 ، R68) تم تصميم الاشعال الخاصة بالجينات (الجدول 1).

      بعد تحديد التسلسل الكلي cpbAs1 تسلسل mRNA (رقم انضمام GenBank. <"type": "entrez-nucleotide" ، "attrs": <"text": "GU818731.1" ، "term_id": "290491365" ، "term_text": "GU818731.1" >> GU818731.1) ، تم تصميم بادئات PCR في الوقت الفعلي (As.RT.F و As.RT.R) من أجل cpbAs1 تحليل التعبير (الجدول 1). أيضا ، من أجل التطبيع ، فإن S7 تم اختيار الجين باعتباره جينًا داخليًا للتدبير المنزلي (11 ، 13) وتم تصميم S7F و S7R وفقًا للتسلسل مع GenBank رقم الانضمام. <"type": "entrez-nucleotide"، "attrs": <"text": "AF539918"، "term_id": "78771839"، "term_text": "AF539918" >> AF539918 (الجدول 1). علاوة على ذلك ، للقضاء على تأثير التلوث الجيني المحتمل للحمض النووي ، تم تصميم بادئات تفاعل البوليميراز المتسلسل في الوقت الحقيقي بناءً على مناطق تقاطع إكسون.

      المعلوماتية الحيوية.

      في هذه الدراسة ، تم تصميم جميع البادئات باستخدام برنامج Gene Runner (الإصدار 3.05 ، 1994 Hastings Software Inc.) وتم فحص خصوصيتها لـ PCR بواسطة nucleotide BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) ). أيضًا ، تم التنبؤ بالبنية ثلاثية الأبعاد للبروتينات بواسطة خادم الويب SWISS-MODEL (http://swissmodel.expasy.org/) ، وتم تحليل ببتيد الإشارة بواسطة خادم SignalP 4.0 (http: // www. cbs.dtu.dk/services/SignalP/).

      بيان الأخلاق.

      تم تنفيذ هذا العمل فقط على عينات البعوض التي تم جمعها في الحقل وعلى سلالة الحشرات من الحشرات الوطنية ، معهد باستير في إيران (PII). بعد، بعدما في السيليكو الدراسات ، بدأت المرحلة المختبرية. بيض ويرقات أ. ستيفنسي تم جمعها من منطقة تشابهار في جنوب شرق إيران ومقاطعة سيستان وبلوشستان. تم الحصول على جميع التصاريح اللازمة للدراسات الميدانية الموصوفة على النحو التالي.

      قبل الموافقة من قبل PII ، تمت مراجعة هذا المشروع والموافقة عليه من قبل اللجنة الأخلاقية لمعلومات PII. وبالتالي ، من أجل جمع البعوض من المساكن الخاصة ، قدم جميع السكان موافقتهم المستنيرة الشفوية على استخدام مساكنهم في الدراسة ، وقد تم تنسيق ذلك من خلال المدير المحلي لبرنامج مكافحة الملاريا في مركز الصحة العامة في مناطق الدراسة. باختصار ، قدم الباحث الرئيسي في المشروع ، ن. دينبارست جديد ، أقسامًا مختلفة من المشروع للموظفين المحليين ، وخاصة قسم المجموعات الميدانية. قبل أسبوع إلى أسبوعين من الجمع الميداني ، قام المدير المحلي لبرنامج مكافحة الملاريا التابع لمركز الصحة العامة بزيارة مناطق الدراسة ، وفي اجتماع مع السكان ، طلب الإذن بجمع البعوض في التاريخ والوقت المحددين. ولأنه إجراء روتيني للأنشطة الأخرى لبرنامج مكافحة الملاريا في المنطقة ، وافق السكان على التعاون في المشروع. ثم تبع المشروع وصول فريق البحث في الموعد والوقت المتفق عليهما داخل مناطق الدراسة ، وتم جمع البعوض. تم توثيق هذا الإجراء في كتاب تقرير النشاط الأسبوعي لبرنامج مكافحة الملاريا في مناطق الدراسة وتم التوقيع عليه من قبل NDD ، المدير المحلي لبرنامج مكافحة الملاريا ، وممثل من مناطق الدراسة. باستثناء المساكن الخاصة ، لم يتم استخدام أي مواقع تجميع أخرى.

      كما تم تحصين الأرانب المستخدمة في هذه الدراسة لإنتاج أجسام مضادة متعددة النسيلة مضادة لـ CPB. تم إصدار ترخيص العمل مع نماذج الحيوانات التجريبية (فأر وأرنب) من قبل وحدة الحيوان في PII إلى A. Raz.

      البعوض.

      بعد، بعدما في السيليكو الدراسات ، بدأت المرحلة المختبرية. بيض ويرقات أ. ستيفنسي تم جمعها من منطقة تشابهار في جنوب شرق إيران ومقاطعة سيستان وبلوشستان. بعد ذلك ، تم نقلهم إلى Insectarium of PII للتكاثر الروتيني بناءً على الظروف القياسية: على وجه التحديد ، نطاق درجة حرارة من 26 إلى 28 & # x000b0C ، ورطوبة 80 ٪ ، ودورة إضاءة / مظلمة لمدة 12 ساعة (13). تم استخدام بعوض ما بعد البعوض في اليوم الخامس في هذه الدراسة.

      استخراج الحمض النووي الريبي للنسخ العكسي القياسي- PCR (RT-PCR).

      تم استخراج إجمالي الحمض النووي الريبي من الأمعاء الوسطى للبعوض الحي المخدر باستخدام مجموعة استخراج الحمض النووي الريبي RNeasy (Qiagen ، ألمانيا) ثم تمت معالجته باستخدام إنزيم DNase I وفقًا لتعليمات الشركة الصانعة (فيرمنتاس ، الولايات المتحدة الأمريكية) لإزالة التلوث المحتمل للحمض النووي. بالإضافة إلى ذلك ، تم فحص تلوث الحمض النووي الجيني بواسطة الاشعال As.RT.F و R427 بعد كل استخراج الحمض النووي الريبي (الجدول 1).

      تم إجراء النسخ العكسي (RT) في حجم نهائي قدره 20 & # x003bcl باستخدام السداسي العشوائي أو الرابط أو التمهيدي الخاص بالجينات (فيما يتعلق بالتفاعل التالي) باعتباره التمهيدي. تم تعديل حجم 5 & # x003bcg من إجمالي الحمض النووي الريبي إلى 14 & # x003bcl عن طريق إضافة الماء المقطر الخالي من RNase. تم ترك الحمض النووي الريبي عند 75 & # x000b0C لمدة 5 دقائق لإزالة الهياكل الثانوية وتم تبريده على الفور على الجليد. بعد ذلك ، تمت إضافة مزيج RT (فيروس سرطان الدم مورين RevertAid Moloney [M-MULV] ، و RNasin ، ومحلول ثلاثي الفوسفات [dNTP] ، ومخزن RT ، والبرايمر) إلى الحمض النووي الريبي المبرد ، وتم بدء RT بواسطة البرنامج التالي: 10 دقائق في 25 & # x000b0C ، 60 دقيقة عند 42 & # x000b0C ، و 10 دقيقة عند 70 & # x000b0C. تم شراء جميع الكواشف من فيرمنتاس ، الولايات المتحدة الأمريكية.

      تم إجراء PCRs بحجم إجمالي 25 & # x003bcl. يحتوي خليط التفاعل على 400 نانومتر (لكل منهما) بادئات ، 1 وحدة من طق بوليميريز الحمض النووي ، 0.2 ملي مولار (لكل منهما) dNTPs ، 0.001٪ جيلاتين ، 2.5 & # x003bcl من 10 & # x000d7 عازلة تفاعل ، 1.5 ملي MgCl2، و 1 & # x003bcl لمنتج تفاعل RT (لـ RT-PCR) أو 100 نانوغرام من الحمض النووي لـ PCR كقالب. كان برنامج التضخيم على النحو التالي: التمسخ الأولي عند 94 & # x000b0C لمدة 5 دقائق ، متبوعًا بـ 30 دورة من التمسخ عند 94 & # x000b0C لمدة 30 ثانية ، التلدين عند 55 & # x000b0C لمدة 50 ثانية ، والتمديد عند 72 & # x000b0C لمدة دقيقة واحدة ، وتمديد نهائي إضافي عند 72 & # x000b0C لمدة 10 دقائق. بعد ذلك ، تم تحليل نواتج تفاعل البوليميراز المتسلسل بواسطة الرحلان الكهربائي لهلام الاغاروز.

      في الخطوة الأولى ، تم استخدام R1 و R2 كبادئات عكسية بالاشتراك مع AnSt314 و AnSt584 و AnSt808 لإجراء PCR على cDNA المحضر مع سداسي عشوائيين. فيما يتعلق بدراساتنا السابقة على جينات مختلفة من أ. ستيفنسي وارتباطها التطوري الوثيق بالمشابه ألف غامبيا الجينات (24 ، 25) ، حجم cpbAs1 تم تقدير منتجات PCR بناءً على موقع التعلق بالأشعال على cpbAg1 تسلسل mRNA (رقم انضمام GenBank. <"type": "entrez-nucleotide" ، "attrs": <"text": "AY545988" ، "term_id": "46487999" ، "term_text": "AY545988" >> AY545988) . بعد ذلك ، تم اختيار مجموعات التمهيدي فقط التي كانت منتجاتها قريبة من الأحجام المتوقعة للتضخيم باستخدام نظام Expand High Fidelity PCR (Roche ، ألمانيا). بعد ذلك ، تم استرداد النطاقات المرغوبة باستخدام مجموعة استخراج الهلام (Qiagen ، ألمانيا) و TA المستنسخة في ناقل pDrive (Qiagen ، ألمانيا). لكل فرقة ، تم تسلسل أكثر من خمسة نسخ باستخدام آلة تسلسل الحمض النووي ABI 310. بعد ذلك ، تمت محاذاة contigs الخاص بهم مع nucleotide BLAST (//blast.ncbi.nlm.nih.gov/Blast.cgi) ، والتسلسلات مع أقصى تشابه مع cpbAg1 وقد تم اختيار.

      3 & # x02032 RACE.

      فيما يتعلق بالجزء الأوسط من تسلسل cpbAs1 جزيء mRNA الذي تم تسلسله في الخطوة السابقة ، تم تصميم أربعة بادئات لـ 3 & # x02032 RACE. أولاً ، تم استخدام الرابط للنسخ العكسي كتمهيدي ، ثم تم استخدام الاشعال الخارجي و AnSt223 في الجولة الأولى من PCR. بعد ذلك ، تم استخدام مزيج Inner (كبداية عكسية) و AnSt297 و AnSt408 و AnSt440 (كبادئات تمهيدية للأمام) في الجولة الثانية من PCR في ثلاثة تفاعلات منفصلة لتأكيد الجولة الأولى. بعد التأكيد ، تم استنساخ منتج PCR من الجولة الأولى وتسلسله (كما هو مذكور أعلاه).

      5 & ​​# x02032 RACE.

      لإجراء 5 & # x02032 RACE ، تم استخدام التمهيدي R427 (كتمهيدي) لتفاعل النسخ العكسي. في نهاية التفاعل ، باستخدام إنزيم ترانسفيراز الطرفي لنزع الأكسجين الريبونوكليوتيد (فيرمنتاس ، الولايات المتحدة الأمريكية) و ATP (فيرمنتاس ، الولايات المتحدة الأمريكية) ، تمت إضافة ذيل بولي (A) إلى نهاية 3 & # x02032 لجزيئات (كدنا) المركبة وفقًا لمصنّع تعليمات. بعد ذلك ، تم استخدام البرايمر linker و R328 (الجدول 1) في الجولة الأولى من PCR. في الجولة الثانية من PCR ، تم استخدام جزيئات cDNA مع بولي مضاف (A) (كعنصر تحكم سلبي) ومنتج PCR من الجولة الأولى (1 & # x003bcl من منتج PCR 1: 20 المخفف) كقوالب لـ R74 (مثل التمهيدي العكسي) والخارجي (مثل التمهيدي الأمامي) في تفاعلين منفصلين. تم استنساخ منتج PCR المؤكد وتسلسله من أجل تحديد تسلسل نهاية 5 & # x02032 cpbAs1 جزيء مرنا.

      الاستنساخ والتعبير المؤتلف CPBAs1 وتنقيته وتحصين الأرانب وقياس الذيفان الداخلي للبروتين المنقى.

      بعد تحديد التسلسل الكامل لملف cpbAs1 تم تصميم جزيء mRNA و ClCPBAs-F و ClCPBAs-R (الجدول 1) مع مواقع تقييد BamHI و XhoI لتضخيم تسلسل تشفير CPBAs1 بدون ببتيد الإشارة الخاص به. بعد تضخيم PCR لـ cDNA مع نظام Expand High Fidelity PCR (Roche ، ألمانيا) والهضم باستخدام BamHI و XhoI ، تم استنساخ منتج PCR المهضوم في ناقل pET-23a المهضوم (Novagen ، الولايات المتحدة الأمريكية) بنفس إنزيمات التقييد. في الخطوة التالية ، تم التحقق من المتجه المؤتلف وتحويله كيميائيًا إلى الإشريكية القولونية اوريغامي ل CPBAs1 في المختبر التعبير.

      باستخدام ناقل pET-23a ، تم التعبير عن شكل مؤتلف من بروتين CPBAs1 للطرف C. بعد 3 ساعات من تحريض الأيزوبروبيل - & # x003b2- d -thiogalactopyranoside (IPTG) ، تم استخدام حمض النيكل نيتريلوترياسيتيك (Ni-NTA) agarose (Qiagen ، ألمانيا) لتنقية CPBAs1 المؤتلف وفقًا لتعليمات الشركة الصانعة.

      لتحديد كمية الذيفان الداخلي البكتيري في البروتين المؤتلف CPBAs1 المنقى ، فإن ليمولوس تم إجراء اختبار محلل الخلايا الأميبية (LAL) في وحدة مراقبة الجودة في مجمع إنتاج البروتين المؤتلف في PII باستخدام مجموعة LAL chromogenic (لونزا ، الولايات المتحدة الأمريكية).

      بعد ذلك ، تم استخدام بروتين CPBAs1 المنقى لتحصين الأرانب بمساعد Freund (Sigma ، ألمانيا). تم استخدام اثنين من الأرانب (اختبار ومراقبة) في هذه الدراسة. قبل التحصين ، تم جمع الدم من الأرانب لتأكيد عملية التحصين وإعاقة اختبارات المقايسة. في اليوم 0 ، تم حقن 100 & # x003bcg من CPBAs1 المؤتلف في محلول ملحي معقم بالفوسفات (PBS) مستحلب بمساعد Freund الكامل (Sigma ، ألمانيا) تحت الجلد في أرنب الاختبار وتم حقن مادة PBS المعقم المساعدة في أرنب التحكم باستخدام نفس البروتوكول في نفس اليوم. في اليوم 21 ، تم حقن 50 & # x003bcg من CPBAs1 المصنوع في مساعد Freund غير المكتمل (Sigma ، ألمانيا) في أرنب الاختبار حيث تم حقن أول مساعد معزّز وغير مكتمل PBS معقم في وقت واحد في أرنب التحكم. تم تكرار بروتوكول التحصين في اليوم 21 في اليوم 42 باعتباره المعزز الثاني (26). أخيرًا ، في اليوم 63 ، تم جمع الدم من الأرانب ، وفصل مصلهما ، وتم تحليل كفاءة التحصين عن طريق النشاف الغربي.

      استخراج البروتين المعى المتوسط ​​البعوض والنشاف الغربي.

      تم فصل عشرين من المعى المتوسطة للبعوض عن طريق التشريح وتم تجانسها باستخدام خالط الأنسجة ومدقة بلاستيكية في 200 & # x003bcl من 25 ملي مولار من حمض الهيدروكلوريك ، الرقم الهيدروجيني 8. ثم ، تم طرد المحلول المتجانس عند 18000 & # x000d7 ز عند 4 & # x000b0C لمدة 15 دقيقة ، تم استخدام المادة الطافية (كوكتيل بروتين المعي المتوسط) للتحليل باستخدام SDS-PAGE والنشاف الغربي.

      تم تحليل كوكتيل البروتين هذا و CPBAs1 المؤتلف ذو العلامات بنسبة 12 ٪ SDS-PAGE ثم تم نقله إلى النيتروسليلوز (Amersham Hybond ECL) من أجل النشاف الغربي. بعد التشبع في PBS الذي يحتوي على 2 ٪ من ألبومين مصل البقر ، تم تحضين الغشاء بأجسام مضادة للأرانب متعددة النسيلة المضادة لـ CPBAs1 (التخفيف ، 1: 1000) التي تم إنتاجها في الخطوات السابقة. تم استخدام الأجسام المضادة المضادة للأرانب المقترنة ببيروكسيديز الفجل (التخفيف ، 1: 5000 سانتا كروز التكنولوجيا الحيوية ، الولايات المتحدة الأمريكية) كجسم مضاد ثانوي ، وتم تصور ارتباطه من خلال احتضان الغشاء بـ SigmaFast diaminobenzidine (DAB) مع مُحسِّن معدني (Sigma ، ألمانيا).

      فحص النشاط البيولوجي

      نظرًا لأنه تم التعبير عن CPBAs1 في شكل zymogen ، لإنتاج إنزيم ناضج (نشط) ، تم إجراء الانقسام التجريبي كما هو موضح بواسطة Ventura et al. (27). باختصار ، تم تعديل تركيز CPBAs1 إلى 1 مجم / مل في مخزن مؤقت للتنشيط (50 ملي مولار تريس- حمض الهيدروكلوريك ، 10 ملي مول كلوريد الكالسيوم2، 150 ملي كلوريد الصوديوم ، درجة الحموضة 8.0). بعد ذلك ، تمت معالجته بنسبة 100: 1 (وزن / وزن) من الزيموجين إلى التربسين عند 25 & # x000b0C في مخزن التنشيط المؤقت لمدة 30 دقيقة.

      تم تقييم النشاط البيولوجي باستخدام ثنائي الببتيدات الاصطناعية hippuryl (Hip) -Arg و Hip-Lys كركيزة خاصة بـ CPB و Hip-Phe (فينيل ألانين) كركيزة خاصة بالكاربوكسي ببتيداز A كما وصفها Lavazec et al. (13). تم شراء جميع الكواشف من Sigma (ألمانيا). باختصار ، 10 نانوغرام / & # x003bcl من CPBAs1 المنشط في المخزن المؤقت E (100 ملي كلوريد الصوديوم ، 50 ملي مولار HEPES ، 100 & # x003bcM ZnCl2، pH 7.2) إلى 20 & # x003bcl من المخزن المؤقت E الذي يحتوي على تركيزات مختلفة من الركائز (اعتمادًا على نوع الفحص) ، ثم تم تحضينه عند 25 & # x000b0C لمدة 30 دقيقة. تم إيقاف التفاعل بإضافة حجم متساوٍ من كاشف النينهيدرين (ميرك ، ألمانيا). تم تحديد نشاط الإنزيم عن طريق قياس الأحماض الأمينية المنبعثة باستخدام إجراء النينهيدرين. تم إجراء تحضير كاشف النينهيدرين ومقايسة النينهيدرين كما وصفه صن وآخرون. (28). أخيرًا ، تم قياس الامتصاصية عند 570 نانومتر بواسطة SmartSpect Plus (Bio-Rad ، الولايات المتحدة الأمريكية) ، وتم تعريف وحدة واحدة من نشاط الإنزيم على أنها & # x003bcmol من الأحماض الأمينية الصادرة / دقيقة.

      كم و كقط تم تحديدها بشكل تجريبي من خلال تسجيل تقدم تفاعل CPBAs1 المحفز بكميات ثابتة من الإنزيم وسلسلة من تركيزات Hip-Arg المختلفة (0.02 إلى 10 ملي مولار) تم إجراء جميع المقايسات في ثلاث نسخ. أخيرًا ، تم استنتاج المعلمات الحركية CPBAs1 من مخطط Lineweaver-Burk.

      تم إجراء المزيد من التوصيفات من خلال اختبار التثبيط باستخدام 1،10-فينانثرولين (عامل مخلب) (سيغما ، ألمانيا) وتناظرية أرجينين GEMSA (2-guanidinoethylmercaptosuccinic acid Santa Cruz Biotechnology ، الولايات المتحدة الأمريكية) على نشاط CPBAs1 مع مثبط 0.1 إلى 1000 & # x003bcM تركيز. أولاً ، تم تحضين المثبط بالشكل النشط لـ CPBAs1 عند 25 & # x000b0C لمدة 30 دقيقة ، وتم تقييم نشاط الإنزيم بواسطة Hip-Arg كما هو موضح أعلاه. أخيرًا ، تم تسجيل النتائج كنسبة مئوية من النشاط في عينات الاختبار بالنسبة لعينات التحكم ، والتي اعتبر نشاطها 100٪ (13).

      ثقافة الطفيليات.

      وفقا للدراسات السابقة ، واحدة من أفضل السلالات المنتجة للخلايا المشيمية المتصورة المنجلية، سلالة 3D7 ، في هذه الدراسة. بشكل مستمر في المختبر في الثقافات ، يبدو أن القدرة على إنتاج الخلايا المشيجية وإصابتها بالعدوى تنخفض بشكل ملحوظ بعد 3 أشهر (29). لذلك ، لمزيد من تكوين الأمشاج وللعدوى الفعالة للبعوض ، تمت زراعة الطفيليات من عينات مذابة حديثًا في فترة أقل من 3 أشهر.

      تمت تربية الطفيليات بشكل مستمر على أساس طريقة Trager و Jensen (30) مع الاستثناء المذكور أعلاه (إعادة تشغيل الثقافات من العينات المذابة حديثًا في فترة تقل عن 3 أشهر). أيضًا ، من أجل عدوى البعوض الفعالة ، لم يتم إضافة كبريتات الجنتاميسين إلى وسط استنبات الطفيل (31).

      بإيجاز ، تمت زراعة الطفيليات في مزرعة مستمرة لمدة تقل عن 3 أشهر على كريات الدم الحمراء البشرية (تم الحصول على فصيلة الدم O + من منظمة نقل الدم ، طهران ، إيران) في وسط RPMI 1640 (Gibco ، الولايات المتحدة الأمريكية) مكملًا بنسبة 10 ٪ مجمعة مصل AB البشري ، 25 مم HEPES ، 25 ملي مولار NaHCO ، درجة الحموضة 7.2. تم تحضين الثقافات عند 37 & # x000b0C في جو من 6 ٪ CO2، 3٪ O2، و 91٪ ن2.

      ثقافة الخلايا المشيمية.

      تم إنتاج الخلايا المشيمية بناءً على الطريقة الموصوفة سابقًا (31) مع تعديلات طفيفة للتحسين. باختصار ، قبل البدء في إنتاج الخلايا المشيمية ، تمت مزامنة مزارع الطفيليات مرتين (في الأيام & # x022128 و & # x022124) إلى مرحلة الحلقة عن طريق العلاج باستخدام 5 ٪ d -sorbitol (32). تم استخدام قوارير زراعة الأنسجة الكبيرة (75 سم 3) لإنتاج الخلايا المشيجية على نطاق واسع. في اليوم 0 ، تم إعداد المزارع عند 0.7٪ طفيليات دم و 6٪ هيماتوكريت في RPMI كاملة. قبل البدء في إنتاج الخلايا المشيمية على نطاق واسع ، تم تسخين القوارير والمتوسطة إلى 37 & # x000b0C لمنع تأثير الصدمة الباردة على الثقافات. متوسط ​​(15 مل وسط كامل لكل قارورة) تم استبداله في نفس الوقت كل يوم. علاوة على ذلك ، تم إجراء استبدال الوسيط في أقل وقت ووضع القوارير على الفور في حاضنة. أيضا ، تم رج القوارير برفق شديد حتى تم اكتشاف ارتفاع نسبة الطفيليات في الدم (عادة حتى اليوم الخامس). تم أخذ المسحات في اليوم الرابع لتحديد أفضل وقت لبدء الخطوة التالية. كان ارتفاع طفيليات الدم والطفيليات التي تظهر علامات الإجهاد (مثل مراحل الحلقة المثلثة ، والجوائز غير الواضحة المظهر ، والشيزونتس) علامات على الوقت المناسب. شوهدت هذه العلامات في اليوم الخامس ، ثم تم تطبيق بعض التغييرات على مزارع الطفيليات. بعد ذلك ، توقف الاهتزاز وزاد حجم الاستبدال المتوسط ​​من 15 مل إلى 22.5 مل. تركيز نهائي 50 ملي مولار ن- تمت إضافة أسيتيل جلوكوزامين إلى وسط كامل لمدة 5 أيام على الأقل لعزل مشيجات المرحلة المتأخرة (المراحل من الثالث إلى الخامس) والقضاء على المراحل اللاجنسية للطفيلي. ن- الأسيتيل جلوكوزامين له سمية انتقائية لل trophozoites و schizonts ويقتل هذه المراحل مع عدم وجود تأثير سام على نمو الخلايا المشيمية (33). يعد القضاء على المراحل اللاجنسية مهمًا جدًا للتجارب الكمية في الوقت الفعلي PCR. تم أخذ مسحات مرتين في الأسبوع لفحص مراحل الطفيل ، والتلوث المحتمل ، والتقدم في القضاء على المراحل اللاجنسية. شوهدت الخلايا المشيمية الناضجة في اليوم الخامس عشر. تم تمييز المراحل المختلفة للخلايا المشيجية وفقًا لإرشادات كارتر وميلر (34) ، وتم إجراء عدوى البعوض في اليوم 17.

      تغذية البعوض.

      تم اختيار إناث البعوض في اليوم الرابع بعد ظهور البعوض وتم تجويعها لمدة 12 ساعة قبل الرضاعة. تم إجراء تغذية الدم الاصطناعية لإناث البعوض في اليوم الخامس بعد ظهور البعوض. تم النظر في ثلاث مجموعات من البعوض لفحوصات منع الإرسال والتحليل الكمي لـ PCR في الوقت الحقيقي: المجموعة 1 ، مجموعة التحكم الكمي في الوقت الحقيقي PCR المجموعة 2 ، مجموعة التحكم في فحص منع الإرسال والمجموعة 3 ، مجموعة اختبار اختبار منع الإرسال . تمت مقارنة المجموعتين 1 و 2 باستخدام تجارب PCR الكمية في الوقت الحقيقي لتحليل تأثير الناضج المتصورة المنجلية المشيجات على cpbAs1 تم تضمين نمط التعبير والمجموعات 2 و 3 في فحوصات منع الانتقال لتقييم تأثير الأجسام المضادة لـ CPBAs1 على تطور الطفيل الجنسي. بعد التغذية ، تم الحفاظ على البعوض المحتقن داخل حشرة الحشرات وتم الاحتفاظ بجميع أقفاص البعوض في نفس الحالة. تم إجراء تغذية الأغشية الاصطناعية وفقًا للطرق الموصوفة سابقًا (35 ، 36).

      تحضير عينات الدم لتغذية البعوض.

      في سلسلة من فحوصات منع الانتقال في اليوم السابع عشر ، تمت إزالة مصل (3 مل [1 مل لكل مجموعة]) من فصيلة الدم البشري الجديد O + بعد الطرد المركزي عند 4000 & # x000d7 ز لمدة 5 دقائق. تم غسل كريات الدم الحمراء المتبقية (كرات الدم الحمراء) ثلاث مرات بكمية متساوية من مصل AB + المعطل بالحرارة. بعد ذلك ، تم تحضير مسحة رقيقة على شريحة زجاجية من مزرعة الطفيل بصبغة جيمسا لتقييم التلوث المحتمل ، ونسبة الكريات الحميدة في الدم ، والدقة في التخلص من الطور اللاجنسي للطفيلي. بعد ذلك ، تمت إزالة وسط الثقافة بالطرد المركزي عند 4000 & # x000d7 ز لمدة 5 دقائق وتم تعديل الكريات الحمر في الدم من كرات الدم الحمراء المغسولة لاختبار منع الانتقال إلى 0.7٪ (1 مل من كرات الدم الحمراء المغسولة لم تكن مصابة واستخدمت لتغذية مجموعة التحكم الكمي PCR [Q-PCR]). بعد ذلك ، تم استبدال حجم متساوٍ من المصل الذي تمت إزالته من كرات الدم الحمراء المغسولة بـ (1) مصل أرنب ساذج قبل التحصين لمجموعات التحكم في فحص Q-PCR وعرقلة انتقال العدوى و (2) مصل الأرانب المحصن ضد CPBAs المؤتلف للإرسال- مجموعة اختبار فحص الحظر. تم تسجيل معدلات وشدة العدوى في كل اختبار معوق في اليوم السابع بعد تغذية الدم ، وتم تحديد الفروق المهمة عن طريق اختبار خي مربع وتحليل التباين (ANOVA) ، على التوالي.

      مقايسة منع انتقال.

      تم تضمين مجموعتين من البعوض في فحوصات منع الانتقال: (1) المجموعة الضابطة التي تم تغذيتها بكرات الدم الحمراء المصابة عن طريق الخلايا المشيمية الناضجة واستبدال مصل الأرانب الساذج و (2) مجموعة الاختبار التي تم تغذيتها بكرات الدم الحمراء المصابة بواسطة الخلايا المشيمية الناضجة ومضادات- توجه CPBAs1 استبدال الأجسام المضادة للأرانب. تم إجراء فحوصات منع النقل والتجارب الكمية في الوقت الحقيقي PCR في ثلاث تجارب مستقلة.

      أخذ العينات واستخراج الحمض النووي الريبي لتحليل التعبير الجيني.

      تم أخذ العينات في 0 (بعد الانتهاء من التغذية) ، 1 ، 3 ، 6 ، 8 ، 24 ساعة بعد تغذية الدم من مجموعة السيطرة والمجموعات المصابة. تم أخذ عينات من ستة بعوض في الأوقات المذكورة من Q-PCR ومجموعات التحكم في اختبار منع انتقال العدوى (إجمالي 36 بعوضة لكل مجموعة) في كل تجربة عدوى ، وتمت مقارنة نتائجها. تم فصل المعى المتوسط ​​للبعوض عن طريق التشريح واحتفظ به عند & # x0221280 & # x000b0C حتى استخراج الحمض النووي الريبي. تم إجراء استخراج الحمض النووي الريبي كما هو موصوف سابقًا ، وتم علاج الحمض النووي الريبي المستخرج أخيرًا باستخدام إنزيم DNase I (فيرمنتاس ، الولايات المتحدة الأمريكية). لتقليل الانحراف أثناء تفاعل النسخ العكسي ، تم إجراء تفاعلات RT في ثلاث نسخ (كما هو موضح أعلاه) وتم تجميع منتجات RT وتقسيمها والاحتفاظ بها عند & # x0221220 & # x000b0C حتى الاستخدام. أيضًا ، لم يتم استخدام المنتجات المذابة (37) ، وتم فحص تلوث الحمض النووي الجيني باستخدام الاشعال As.RT.F و R427 (الجدول 1) بعد كل استخراج من الحمض النووي الريبي. علاوة على ذلك ، تم تضمين عنصر تحكم سلبي في تفاعلات النسخ العكسي للتحقق من تلوث الحمض النووي الجيني في تجارب PCR الكمية في الوقت الفعلي.

      الوقت الحقيقي الكمي PCR.

      تم تنفيذ PCR في الوقت الحقيقي الكمي في ثلاث نسخ باستخدام Power SYBR Green PCR Master Mix (Applied Biosystems ، المملكة المتحدة) وأداة Roto-Gene Q (Qiagen ، الولايات المتحدة الأمريكية). تم إجراء PCRs في 20 - & # x003bcl مجلدات نهائية تحتوي على 900 نانومتر (لكل منهما) بادئات أمامية وعكسية ، 5 & # x003bcl من تخفيف 1: 5 لمنتج RT المجمع ، و 10 & # x003bcl من 2 & # x000d7 مكونات Master Mix طبقاً لتعليمات الشركة الصانعة.

      دورة العتبة (2 & # x02212 & # x00394 & # x00394CT ) من أجل التحليل الكمي لبيانات PCR في الوقت الحقيقي. أيضًا ، من أجل التحقق من صحته & # x00394 & # x00394جتي الحساب ، & # x00394جتي من S7 و cpbAs1 تم تقييم الجينات في تخفيفات قالب مختلفة وفقًا لإرشادات Livak و Schmittgen (38). تم إجراء PCR الكمي لثلاث إصابات مستقلة ، وتمت مقارنة نتائجها بواسطة اختبار Wilcoxon (11).

      أرقام دخول تسلسل النوكليوتيدات.


      التحلل البروتيني المشترك وما بعد الترجمة للبروتينات

      لويد دي فريكر ، في الإنزيمات ، 2002

      ج - التوجيه داخل الخلايا للكربوكسى ببتيداس د

      على الرغم من وجودها بشكل أساسي في TGN ، إلا أن دورات CPD بين هذه المقصورة وسطح الخلية ( 122 ). مثل بروتينات TGN الأخرى التي تدور أيضًا إلى سطح الخلية ، فإن ذيل العصارة الخلوية ضروري لتهريب البروتين. استكشفت الدراسات حول توجيه CPD ثلاثة مجالات: الأجزاء التي يوجد بها CPD ، والعناصر الموجودة داخل CPD التي تتحكم في التوجيه ، والبروتينات الخلوية التي تتفاعل مع CPD للتأثير على التوجيه. بالإضافة إلى وجوده في TGN ، يتم اكتشاف CPD أيضًا في حويصلات كبيرة تشبه الحويصلات الإفرازية غير الناضجة داخل خلايا AtT-20 ( 49 ). ومع ذلك ، فإن جميع الحويصلات الإفرازية ذات النواة الكثيفة الناضجة تقريبًا خالية من CPD ، مما يشير إلى أن هذا البروتين يتم إزالته من الحويصلات غير الناضجة أثناء نضجها ( 49 ). بناءً على هذه الملاحظات ، وعلى نتائج تحليل الحذف التي تمت مناقشتها أدناه ، يبدو أن تهريب CPD مشابه لتلك الموجودة في الفورين وبروتينات TGN الأخرى ، يتم إثراء هذه البروتينات في TGN إما عن طريق آلية الاحتفاظ أو عن طريق الاسترداد من post- حويصلات TGN. يوفر مسار الاسترجاع حلقة إعادة تدوير محلية لـ CPD داخل TGN. Another local recycling loop is thought to be present at the cell surface ( 125 ). Following uptake of CPD from the cell surface, the protein can return to the cell surface, return to the TGN, or enter lysosomes. Movement between the various compartments may be controlled by phosphorylation/dephosphorylation, as proposed for the trafficking of furin ( 125 ).

      Studies examining the regions of CPD that affect transport have identified several important elements ( 126 ). Removal of 49 of the 58 residues of the CPD cytosolic tail causes the protein to accumulate on the cell surface or within the cell surface recycling loop ( 126 ). Attachment of the transmembrane domain and cytosolic tail of CPD to albumin, which is normally secreted via the constitutive secretory pathway, causes the albumin to accumulate in the TGN and to cycle to and from the cell surface ( 127 ). Deletion of the C-terminal 10 amino acids greatly increases the rate of entry of CPD into nascent secretory vesicles that bud from the TGN, suggesting that this region contains a TGN-retention element (Oleg Varlamov and Lloyd Fricker, unpublished). The half-life of the C-terminally truncated protein is also shorter than that of wild-type CPD ( 126 ). Thus, decreasing the retention of CPD within the TGN leads to a greater flux of protein to the cell surface and subsequently to lysosomes. Point mutations have revealed that the phenylalanine within a FHRL sequence is important for the return of CPD from the cell surface to the TGN ( 126 ) this FHRL resembles a tyrosine-containing motif found in a variety of other TGN proteins ( 126 ).

      Several proteins or protein complexes have been found to bind to the cytosolic tail of CPD, including adaptor protein 1 (AP1), adaptor protein 2 (AP2), a protein designated PACS1, and protein phosphatase 2A (PP2A) ( 127 ) (and Oleg Varlamov, Gary Thomas, and Lloyd Fricker, unpublished). All of these proteins or protein complexes have been implicated in the trafficking of other TGN proteins and are presumably involved in the intracellular movement of CPD. The analysis of deletion and point mutations suggests that AP1 and AP2 bind to a FHRL sequence in the CPD tail (Oleg Varlamov and Lloyd Fricker, unpublished), which is similar to the YxxL motifs known to bind to this protein complex ( 128 ). PACS1 binds to the CPD tail only after phosphorylation by casein kinase II (Oleg Varlamov, Lloyd Fricker, and Gary Thomas, unpublished), as is the case for binding of PACS1 to furin ( 129 ). PACS1 is thought to mediate the retrieval of phosphorylated TGN proteins to the TGN and/or the cell surface via a local recycling loop. In this model, a dephosphorylation step is required for the proteins to escape the local recycling loop ( 125, 129, 130 ). PP2A was implicated as the phosphatase that mediates this step for the trafficking of furin ( 125 ). The recent finding that PP2A binds to the cytosolic tail of CPD ( 127 ) is consistent with this model.


      Carboxypeptidase B antibody [N1C1]

      Rat tissue extract (50 μg) was separated by 10% SDS-PAGE, and the membrane was blotted with Carboxypeptidase B antibody [N1C1] (GTX105170) diluted at 1:3000. The HRP-conjugated anti-rabbit IgG antibody (GTX213110-01) was used to detect the primary antibody.

      GTX105170 WB Image

      Mouse tissue extract (50 μg) was separated by 10% SDS-PAGE, and the membrane was blotted with Carboxypeptidase B antibody [N1C1] (GTX105170) diluted at 1:3000. The HRP-conjugated anti-rabbit IgG antibody (GTX213110-01) was used to detect the primary antibody.

      GTX105170 WB Image

      Various whole cell extracts (30 μg) were separated by 10% SDS-PAGE, and the membrane was blotted with Carboxypeptidase B antibody (GTX105170) diluted at 1:500.


      CPB2 and CPN substrates

      Both CPB2 and CPN cleave C-terminal basic amino acids from proteins or peptides. CPN was originally identified as an enzyme that inactivated kinins and anaphylatoxins, whereas CPB2 was identified because of its retardation of fibrinolysis via fibrin as the substrate. Subsequently, it was shown that, as well as kinins and anaphylatoxins, SDF1α and vascular endothelial growth factor-A are substrates for CPB2 in a hemophilic arthropathy mouse model and mouse angiogenesis models, respectively 43, 44 . Cleavage of all of the substrates for CPB2 and CPN2 except one leads to their inactivation, such as the conversion of C5a to C5adesArg, or the reduction in plasmin generation when C-terminal Lys residues in partially digested fibrin are cleaved. The exception is chemerin158K, an adipokine and chemoattractant, which is activated by cleavage of the C-terminal Lys to chemerin 157S 45 .

      If the substrate specificities of CPB2 and CPN were different, it would suggest that they have different physiological roles. Several substrates have had their kinetics determined في المختبر by measurement of cleavage rates of peptides representing the C-terminus. The results show that catalytic efficiency (كقط/كم) does not vary very much between CPB2 and CPN (Fig. 3), although some substrates do differ. CPN, which is commonly regarded as the physiological inactivator of kinins and anaphylatoxins, is less efficient for hydrolysis of bradykinin (BK), thrombin-cleaved osteopontin, and C5a, with catalytic efficiencies approximately nine-fold, 26-fold and 10-fold lower, respectively, than those of CPB2 46 . Conversely, CPN is more effective for removal of Lys from fibrin peptides in this assay, a property for which CPB2 was named TAFI, and CPN can retard fibrinolysis في المختبر 47 .

      Enzyme turnover of carboxypeptidase B2 (CPB2) and carboxypeptidase N (CPN). Peptides representing the C-terminus of basic carboxypeptidase substrates had their kinetic constants determined by incubation with CPN ( ) or CPB2 (), and this was followed by determination of their cleavage with HPLC. The data are from Myles وآخرون. 46 and Du وآخرون. 45 , and are presented as turnover (log كقط/كم). BK, bradykinin FB, fibrinogen OPN, osteopontin. [Color figure can be viewed at wileyonlinelibrary.com]

      Various physiological substrates have been suggested, but very few of these have been confirmed في الجسم الحي by use of either pharmacological interventions or genetically deficient mice. CPN is a physiological inactivator of C5a, as demonstrated both by administration of inhibitors and by challenge with C5a in Cpn / mice 48, 49 . Inhibition of CPB2 with various specific compounds accelerates fibrinolysis, demonstrating that fibrin is a physiological substrate for it, but only a few reports utilizing Cpb2 / mice were able to confirm this 50 . Both C3a and C5a are physiological substrates for CPB2 in models of polymicrobial sepsis induced by cecal ligation and puncture 51 and hemolytic–uremic syndrome (HUS) 52 .


      B1. Carboxypeptidase - Biology

      Jsou známa bezpečnostní rizika a prohlížeč možná nedokáže zobrazit všechny prvky této a dalších webových stránek.

      BOUCHAL, Pavel, Monika DVOŘÁKOVÁ, Theodoros ROUMELIOTIS, Zbyněk BORTLÍČEK, Ivana IHNATOVÁ, Iva PROCHÁZKOVÁ, JTC HO, Josef MARYÁŠ, Hana IMRICHOVÁ, Eva BUDINSKÁ, Rostislav VYZULA, SD GARBIS, Bořivoj VOJTĚŠEK a Rudolf NENUTIL. Combined Proteomics and Transcriptomics Identifies Carboxypeptidase B1 and Nuclear Factor kappa B (NF-kappa B) Associated Proteins as Putative Biomarkers of Metastasis in Low Grade Breast Cancer. MOLECULAR & CELLULAR PROTEOMICS. BETHESDA: AMER SOC BIOCHEMISTRY MOLECULAR BIOLOGY INC, 2015, roč. 14, č. 7, s. 1814-1830. ISSN 1535-9476. doi:10.1074/mcp.M114.041335.
      Další formáty: BibTeX LaTeX RIS

      TY - JOUR
      ID - 1308775
      AU - Bouchal, Pavel - Dvořáková, Monika - Roumeliotis, Theodoros - Bortlíček, Zbyněk - Ihnatová, Ivana - Procházková, Iva - Ho, JTC - Maryáš, Josef - Imrichová, Hana - Budinská, Eva - Vyzula, Rostislav - Garbis, SD - Vojtěšek, Bořivoj - Nenutil, Rudolf
      PY - 2015
      TI - Combined Proteomics and Transcriptomics Identifies Carboxypeptidase B1 and Nuclear Factor kappa B (NF-kappa B) Associated Proteins as Putative Biomarkers of Metastasis in Low Grade Breast Cancer
      JF - MOLECULAR & CELLULAR PROTEOMICS
      VL - 14
      IS - 7
      SP - 1814-1830
      EP - 1814-1830
      PB - AMER SOC BIOCHEMISTRY MOLECULAR BIOLOGY INC
      SN - 15359476
      KW - Breast cancer
      KW - metastasis
      KW - low grade
      KW - biomarkers
      KW - cancer biology
      KW - gene expression
      KW - iTRAQ
      KW - mass spectrometry
      KW - Orbitrap FTMS
      KW - transcriptomics
      KW - Carboxypeptidase B1
      KW - NFkB
      N2 - Current prognostic factors are insufficient for precise risk-discrimination in breast cancer patients with low grade breast tumors, which, in disagreement with theoretical prognosis, occasionally form early lymph node metastasis. To identify markers for this group of patients, we employed iTRAQ-2DLC-MS/MS proteomics to 24 lymph node positive and 24 lymph node negative grade 1 luminal A primary breast tumors. Another group of 48 high-grade tumors (luminal B, triple negative, Her-2 subtypes) was also analyzed to investigate marker specificity for grade 1 luminal A tumors. From the total of 4405 proteins identified (FDR<5%), the top 65 differentially expressed together with 30 previously identified and control markers were analyzed also at transcript level. Increased levels of carboxypeptidase B1 (CPB1), PDZ and LIM domain protein 2 (PDLIM2), and ring finger protein 25 (RNF25) were associated specifically with lymph node positive grade 1 tumors, whereas stathmin 1 (STMN1) and thymosin beta 10 (TMSB10) associated with aggressive tumor phenotype also in high grade tumors at both protein and transcript level. For CPB1, these differences were also observed by immunohistochemical analysis on tissue microarrays. Upregulation of putative biomarkers in lymph node positive (versus negative) luminal A tumors was validated by gene expression analysis of an independent published data set (n = 343) for CPB1 (p = 0.00155), PDLIM2 (p = 0.02027) and RELA (p = 0.00015). Moreover, statistically significant connections with patient survival were identified in another public data set (n = 1678). Our findings indicate unique pro-metastatic mechanisms in grade 1 tumors that can include up-regulation of CPB1, activation of NF-kappa B pathway and changes in cell survival and cytoskeleton. These putative biomarkers have potential to identify the specific minor subpopulation of breast cancer patients with low grade tumors who are at higher than expected risk of recurrence.
      ER -


      B1. Carboxypeptidase - Biology

      An official website of the United States government

      Official websites use .gov
      أ .gov website belongs to an official government organization in the United States.

      Secure .gov websites use HTTPS
      أ lock ( Lock A locked padlock

      ) or https:// means you’ve safely connected to the .gov website. Share sensitive information only on official, secure websites.

      U.S. DEPARTMENT OF AGRICULTURE

      Hard Winter Wheat Genetics Research: Manhattan, KS

      ARS-wide

      At this Location

      عنوان: CLONING AND CHARACTERIZATION OF CDNAS ENCODING CARBOXYPEPTIDASE-LIKE PROTEINS FROM THE GUT OF HESSIAN FLY [MAYETIOLA DESTRUCTOR (SAY)] LARVAE

      Interpretive Summary: One important method for controlling pest insects that attack plants is to inhibit their digestive enzymes. Previous work has focused on one type of digestive enzyme called an endopeptidase because it breaks down proteins by cutting them apart in the middle. This work describes our efforts to characterize a different type of digestive enzyme called an exopeptidase because it breaks down proteins by cutting pieces off each end rather than in the middle. We analyzed the digestive enzymes in the larval stage of the Hessian fly, one of the most destructive pests of wheat plants. We found five genes that code for three different exopeptidase enzymes called carboxypeptidase A, carboxypeptidase B, and carboxypeptidase D. Our results show that carboxypeptidase A and B are the major digestive enzymes in Hessian fly larvae. Therefore, future research will focus on finding methods to inhibit these enzymes as means of controlling this significant insect pest.

      Technical Abstract: Transcriptomic analysis of the gut from Hessian fly [Mayetiola destructor (Say)] larvae identified nine unique cDNA clones that encode carboxypeptidase-like proteins. Sequence comparison and phylogenetic analysis sorted these cDNAs into five groups named MDCP-A1, MDCP-A2, MDCP-B1, MDCP-B2, and MDCP-D, according to their putative functional specificity. Among the five groups, MDCP-A1 and MDCP-A2 encoded carboxypeptidase A MDCP-B1 and MDCP-B2 encoded carboxypeptidase B and MDCD-D encoded carboxypeptidase D based on sequence similarities to those of well characterized proteins in public databases. All residues characteristic of metallocarboxypeptidases including the HXXE motif were conserved among all members. Northern blot analysis revealed various expression patterns for different gene groups in different developmental stages of M. destructor, suggesting that different carboxypeptidases perform different functions or have different specificities. Enzymatic activity assays demonstrated that both carboxypeptidase A and B are predominant in the larval stage, indicating a role of carboxypeptidase A and B in food digestion since larva is the only feeding stage of M. destructor. The digestive role is further supported by the fact that over 80% of the enzymatic activitiy in larvae occurred in the gut. Among these two types of enzymes, the enzymatic activity of carboxypeptidase A was at least four times higher than that of carboxypeptidase B under the same conditions, suggesting that carboxypeptidase A is the major digestive enzymes in the gut of M. destructor larvae.


      Arginine carboxypeptidase

      Carboxypeptidase E — Carboxypeptidase E, also known as CPE, is a human gene.cite web | title = Entrez Gene: CPE carboxypeptidase E| url = http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene Cmd=ShowDetailView TermToSearch=1363| accessdate = ] PBB Summary section title … Wikipedia

      كربوكسي ببتيداز — (EC number 3.4.16 3.4.18) is an enzyme that hydrolyzes the carboxy terminal (C terminal) end of a peptide bond. Humans, animals, and plants contain several types of carboxypeptidases with diverse functions ranging from catabolism to protein… … Wikipedia

      Carboxypeptidase B — protein Name=carboxypeptidase B1 (tissue) caption= width= HGNCid=2299 Symbol=CPB1 AltSymbols= EntrezGene=1360 OMIM=114852 RefSeq=NM 001871 UniProt=P15086 PDB= ECnumber=3.4.17.2 Chromosome=3 Arm=q Band=24 LocusSupplementaryData=protein… … Wikipedia

      كربوكسي ببتيداز — Enzymes (particularly of pancreas) that remove the C terminal amino acid from a protein or peptide. Carboxypeptidase A, (EC 3.4.17.1) will remove any amino acid carboxypeptidase B (EC 3.4.17.2) is specific for terminal lysine or arginine … Dictionary of molecular biology

      carboxypeptidase A — A hydrolase that releases C terminal amino acid s, with the exception of C terminal arginyl, lysyl, and prolyl residues. A zinc containing exopeptidase. * * * car·boxy·pep·ti·dase A (kahr bok″se pepґtĭ dās) [EC 3.4.17.1] an enzyme … Medical dictionary

      carboxypeptidase B — A hydrolase that releases C terminal lysyl or arginyl residues preferentially. A zinc containing exopeptidase. SYN: protaminase. * * * car·boxy·pep·ti·dase B (kahr bok″se pepґtĭ dās) [EC 3.4.17.2] an enzyme of the hydrolase class… … Medical dictionary

      lysine carboxypeptidase — ly·sine car·boxy·pep·ti·dase (liґsēn kahr bok″se pepґtĭ dās) [EC 3.4.17.3] an enzyme of the hydrolase class that catalyzes the removal of C terminal basic amino acids from peptides, preferentially removing lysine residues but … Medical dictionary


      شاهد الفيديو: Protein Classification u0026 functions - تصنيف البروتينات ووظائفها - تعلم بالعربي (أغسطس 2022).