معلومة

ماوس صلب (C57BL / 6) بادئات WT

ماوس صلب (C57BL / 6) بادئات WT


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أحاول الحصول على زوج جيد (أو الأفضل من ذلك ، مكتبة من الأزواج) من البادئات التي تعطيني نطاقًا واحدًا في الفئران WT (C57BL / 6). هل تعرف أين يمكنني أن أجد مثل هذا الشيء؟

بدلاً من ذلك ، فكرت في تصميم مجموعات قليلة من البادئات بنفسي للمناطق المحمية بشدة. لكن هذا قدر كبير من التخمين (ما هي المناطق ، وما الأزواج من ماذاإبريمير 3سيحسب لي وما إلى ذلك).

وبالتالي:

  • هل تعرف أين يمكن العثور على قاعدة البيانات هذه؟
  • إذا لم يكن الأمر كذلك ، فهل يمكنك مساعدتي في البدء في إنشائه بنفسي؟ ما هي المناطق المحددة في رأيك ستكون جيدة بشكل خاص لهذا الغرض؟

لقد استقرت على اثنين من البادئات GAPDH مع amplicon قصير (~ 50 نقطة أساس):

> gapdh_rv3  GAGACCTGAATGCTGCTTCC> gapdh_fw3  CTCCATTTCCCCTGTTCTCC

أنها توفر ضوابط متسقة وجيدة ، كما هو موضح هنا (النطاقات السفلية):


خيارات الوصول

احصل على حق الوصول الكامل إلى دفتر اليومية لمدة عام واحد

جميع الأسعار أسعار صافي.
سيتم إضافة ضريبة القيمة المضافة في وقت لاحق عند الخروج.
سيتم الانتهاء من حساب الضريبة أثناء الخروج.

احصل على وصول محدود أو كامل للمقالات على ReadCube.

جميع الأسعار أسعار صافي.


Akinsete JA، Ion G، Witte TR، Hardman WE (2012) تناول نظام غذائي عالي الأحماض الدهنية أوميغا 3 قمع تكوّن أورام البروستاتا في C3 (1) تاج الفئران. التسرطن 33 (1): 140-148. https://doi.org/10.1093/carcin/bgr238

أكرم م ، إقبال م ، دانيال م ، خان إيه يو (2017) الوعي والمعرفة الحالية بسرطان الثدي. بيول ريس 50 (1): 33. https://doi.org/10.1186/s40659-017-0140-9

Almind K، Kulkarni RN، Lannon SM، Kahn CR (2003) تحديد المواقع التفاعلية المرتبطة بالأنسولين واللبتين في الفئران ذات المقاومة الجينية للأنسولين. داء السكري 52 (6): 1535-1543. https://doi.org/10.2337/diabetes.52.6.1535

Aprelikova O، Tomlinson CC، Hoenerhoff M، Hixon JA، Durum SK، Qiu TH، He S، Burkett S، Liu ZY، Swanson SM، Green JE (2016) التطوير والتطبيق قبل السريري لنموذج زرع ذات كفاءة مناعية لسرطان الثدي القاعدي مع الرئة والنقائل الكبد والدماغ. بلوس واحد 11 (5): e0155262. https://doi.org/10.1371/journal.pone.0155262

Araujo MR و Campos LC و Damasceno KA و Gamba CO و Ferreira E و Cassali GD (2016) تعبير HER-2 و EGFR و Cox-2 و Ki67 في ورم خبيث في العقدة الليمفاوية لسرطان الثدي في الكلاب: الارتباط بالمعايير السريرية المرضية والبقاء الكلي . الدقة البيطرية العلوم 106: 121-130. https://doi.org/10.1016/j.rvsc.2016.03.020

Armstrong NJ، Brodnicki TC، Speed ​​TP (2006) انتبه للفجوة: تحليل استراتيجيات التربية بمساعدة العلامات لسلالات الفئران الفطرية. مام جينوم 17 (4): 273-287. https://doi.org/10.1007/s00335-005-0123-y

Asada N ، Kunisaki Y ، Pierce H ، Wang Z ، Fernandez NF ، Birbrair A ، Ma’ayan A ، Frenette PS (2017) مساهمات السيتوكينات التفاضلية لمنافذ الخلايا الجذعية المكونة للدم حول الأوعية. نات سيل بيول. https://doi.org/10.1038/ncb3475

Baak JP، van Diest PJ، Voorhorst FJ، van der Wall E، Beex LV، Vermorken JB، Janssen EA (2005) سنوات. J كلين أونكول 23 (25): 5993-6001. https://doi.org/10.1200/JCO.2005.05.511

Balkwill FR ، Capasso M ، Hagemann T (2012) البيئة الدقيقة للورم في لمحة. J Cell Sci 125 (Pt 23): 5591–5596. https://doi.org/10.1242/jcs.116392

Birbrair A ، Wang ZM ، Messi ML ، Enikolopov GN ، Delbono O (2011) يكشف التحور الجيني Nestin-GFP عن الخلايا العصبية في العضلات الهيكلية للبالغين. بلوس واحد 6 (2): e16816. https://doi.org/10.1371/journal.pone.0016816

Birbrair A، Zhang T، Wang ZM، Messi ML، Enikolopov GN، Mintz A، Delbono O (2013a) دور الحبيبات في تجديد العضلات والهيكل العظمي وتراكم الدهون. الخلايا الجذعية تتطور 22 (16): 2298-2314. https://doi.org/10.1089/scd.2012.0647

Birbrair A ، Zhang T ، Wang ZM ، Messi ML ، Enikolopov GN ، Mintz A ، Delbono O (2013b) تظهر الخلايا العصبية للعضلات الهيكلية خصائص NG2-الدبقية. دقة خلية الخبرة 319 (1): 45-63

Birbrair A و Zhang T و Wang ZM و Messi ML و Enikolopov GN و Mintz A و Delbono O (2013c) تختلف الأنواع الفرعية للعضلات الهيكلية في إمكانات التمايز. دقة الخلايا الجذعية 10 (1): 67-84

Birbrair A ، Zhang T ، Wang ZM ، Messi ML ، Mintz A ، Delbono O (2013d) يشارك النوع 1 pericytes في ترسب الأنسجة الليفية في العضلات الهيكلية المسنة. Am J Physiol Cell Physiol 305 (11): C1098-1113. https://doi.org/10.1152/ajpcell.00171.2013

Birbrair A، Zhang T، Files DC، Mannava S، Smith T، Wang ZM، Messi ML، Mintz A، Delbono O (2014a) تتراكم الحبيبات من النوع 1 بعد إصابة الأنسجة وتنتج الكولاجين بطريقة تعتمد على الأعضاء. تحليل الخلايا الجذعية 5 (6): 122. https://doi.org/10.1186/scrt512

Birbrair A و Zhang T و Wang ZM و Messi ML و Olson JD و Mintz A و Delbono O (2014b) تشارك الخلايا الحبيبية من النوع 2 في تكوين الأوعية الطبيعية والورم. Am J Physiol Cell Physiol 307 (1): C25-38. https://doi.org/10.1152/ajpcell.00084.2014

Birbrair A ، Sattiraju A ، Zhu D ، Zulato G ، Batista I ، Nguyen VT ، Messi ML ، Solingapuram Sai KK ، Marini FC ، Delbono O ، Mintz A (2017) الخلايا الجذعية المستمدة من المحيطات الجديدة مثل الخلايا الجذعية كناقلات علاجية لعلاج الأورام الأرومية الدبقية . ترجمة الخلايا الجذعية في المتوسط ​​6 (2): 471-481. https://doi.org/10.5966/sctm.2016-0007

Boyd NF ، Martin LJ ، Bronskill M ، Yaffe MJ ، Duric N ، Minkin S (2010) تكوين أنسجة الثدي والقابلية للإصابة بسرطان الثدي. J Natl Cancer Inst 102 (16): 1224-1237. https://doi.org/10.1093/jnci/djq239

Bray F و Ferlay J و Soerjomataram I و Siegel RL و Torre LA و Jemal A (2018) إحصائيات السرطان العالمية 2018: تقديرات GLOBOCAN للوقوع والوفيات في جميع أنحاء العالم لـ 36 حالة سرطان في 185 دولة. سرطان كاليفورنيا ي كلين 68 (6): 394-424. https://doi.org/10.3322/caac.21492

Bridges AE، Ramachandran S، Pathania R، Parwal U، Lester A، Rajpurohit P، Morera DS، Patel N، Singh N، Korkaya H، Manicassamy S، Prasad PD، Lokeshwar VB، Lokeshwar BL، Ganapathy V، Thangaraju M (2020) يقلل نقص RAD51AP1 من نمو الورم من خلال استهداف التجديد الذاتي للخلايا الجذعية. الدقة السرطان 80 (18): 3855-3866. https://doi.org/10.1158/0008-5472.CAN-19-3713

Brock A و Krause S و Li H و Kowalski M و Goldberg MS و Collins JJ و Ingber DE (2014) إسكات HoxA1 ​​عن طريق الحقن داخل الجسيمات النانوية الدهنية siRNA يمنع تطور ورم الثدي في الفئران. Sci Transl Med 6 (217): 217ra212

Bryant CD (2011) بركات ولعنات C57BL / 6 subrains في الدراسات الوراثية للفأر. Ann N Y Acad Sci 1245: 31–33. https://doi.org/10.1111/j.1749-6632.2011.06325.x

Burd CE، Sorrentino JA، Clark KS، Darr DB، Krishnamurthy J، Deal AM، Bardeesy N، Castrillon DH، Beach DH، Sharpless NE (2013) مراقبة تكوين الأورام والشيخوخة في الجسم الحي باستخدام نموذج p16 (INK4a) -luciferase. الخلية 152 (1-2): 340-351. https://doi.org/10.1016/j.cell.2012.12.010

السرطان IAfRo (2019) ، تصنيفات منظمة الصحة العالمية للأورام ، هيئة التحرير ، المجلد 2. تصنيف منظمة الصحة العالمية لسلسلة الأورام ، الطبعة الخامسة

Caruso JA، Akli S، Pageon L، Hunt KK، Keyomarsi K (2015) يحافظ مثبط الأنزيم البروتيني السيرين elafin على التحكم في النمو الطبيعي من خلال مقاومة التأثيرات الانقسامية للإيلاستاز العدلات. الجين الورمي 34 (27): 3556–3567. https://doi.org/10.1038/onc.2014.284

Cheung KJ، Gabrielson E، Werb Z، Ewald AJ (2013) يتطلب الغزو الجماعي لسرطان الثدي وجود برنامج ظهاري قاعدي محفوظ. الخلية 155 (7): 1639–1651. https://doi.org/10.1016/j.cell.2013.11.029

Christenson JL ، Butterfield KT ، Spoelstra NS ، Norris JD ، Josan JS ، Pollock JA ، McDonnell DP ، Katzenellenbogen BS ، Katzenellenbogen JA ، Richer JK (2017) MMTV-PyMT وخلايا الورم الثديية الفأرية المشتقة من Met-1 كنماذج لدراسة الدور مستقبلات الاندروجين في تطور سرطان الثدي الثلاثي السلبي. سرطان الهرمون 8 (2): 69-77. https://doi.org/10.1007/s12672-017-0285-6

Coimbra-Campos LMC، Silva WN، Baltazar LM، Costa PAC، Prazeres PHDM، Picoli CC، Costa AC، Rocha BGS، Santos GSP، Oliveira FMS، Pinto MCX، Amorim JH، Azevedo VAC، Souza DG، Russo RC، Resende RR، Mintz A ، Birbrair A (2021) تشارك خلايا Nestin-GFP + المتداولة في التسبب في الإصابة بـ Paracoccidioides brasiliensis في الرئتين. مراجعات وتقارير الخلايا الجذعية. https://doi.org/10.1007/s12015-021-10181-3

Colpaert C ، Vermeulen P ، Jeuris W ، van Beest P ، Goovaerts G ، Weyler J ، Van Dam P ، Dirix L ، Van Marck E (2001) لا يتم توقع الانتكاس المبكر البعيد في مرضى سرطان الثدي "سلبي العقدة" من قبل إبط غامض انبثاث العقدة الليمفاوية ، ولكن من خلال ملامح الورم الأساسي. جي باتول .193 (4): 442-449. https://doi.org/10.1002/path.829

Colpaert CG ، Vermeulen PB ، Fox SB ، Harris AL ، Dirix LY ، Van Marck EA (2003) يرتبط وجود التركيز الليفي في سرطان الثدي الغازي بالتعبير عن الأنهيدراز الكربوني IX وهو علامة على نقص الأكسجة وضعف التشخيص. علاج الدقة لسرطان الثدي 81 (2): 137-147. https://doi.org/10.1023/A:1025702330207

Cox TR ، Erler JT (2011) إعادة عرض واستتباب المصفوفة خارج الخلية: الآثار المترتبة على الأمراض الليفية والسرطان. Dis Model Mech 4 (2): 165–178. https://doi.org/10.1242/dmm.004077

Daniels SR ، Liyasova M ، Kales SC ، Nau MM ، Ryan PE ، Green JE ، Lipkowitz S (2019) فقدان وظيفة طفرات Cbl-c في الأورام الصلبة. بلوس واحد 14 (7): e0219143. https://doi.org/10.1371/journal.pone.0219143

Davie SA ، Maglione JE ، Manner CK ، Young D ، Cardiff RD ، MacLeod CL ، Ellies LG (2007) تأثيرات خلفيات الإجهاد FVB / NJ و C57Bl / 6J على النمط الظاهري لورم الثدي في الفئران التي تعاني من نقص أكسيد النيتريك المحرض. الدقة المحورة جينيا 16 (2): 193 - 201. https://doi.org/10.1007/s11248-006-9056-9

de Mingo PA، Gardner A، Hiebler S، Soliman H، Rugo HS، Krummel MF، Coussens LM، Ruffell B (2018) ينظم TIM-3 وظيفة الخلايا المتغصنة CD103 (+) والاستجابة للعلاج الكيميائي في سرطان الثدي. خلية سرطانية 33 (1): 60-74 e66. https://doi.org/10.1016/j.ccell.2017.11.019

de Visser KE، Eichten A، Coussens LM (2006) الأدوار المتناقضة لجهاز المناعة أثناء تطور السرطان. نات ريف كانسر 6 (1): 24-37. https://doi.org/10.1038/nrc1782

ديب كيه كيه ، ميشالوسكا آم ، يون سي واي ، كرومي إس إم ، هونرهوف إم جي ، كافانو سي ، لي إم سي ، ديمايو إف جي ، لينويلا 1 ، دينغ سي إكس ، لي إي واي ، ميدينا دي ، شيه جي إتش ، جرين جي إي (2007) تحديد SV40 T متكامل / t- مستضد السرطان توقيعه في الثدي البشري العدواني ، البروستاتا ، وسرطان الرئة مع التشخيص السيئ. الدقة السرطان 67 (17): 8065-8080. https://doi.org/10.1158/0008-5472.CAN-07-1515

Dehdashti F، Wu N، Ma CX، Naughton MJ، Katzenellenbogen JA، Siegel BA (2021) Association of PET-based estradiol-Challenge test for breast cancer progesterone receptors with response to endocrine therapy. نات كومون 12 (1): 733. https://doi.org/10.1038/s41467-020-20814-9

DeNardo DG، Coussens LM (2007) التهاب وسرطان الثدي. موازنة الاستجابة المناعية: الحديث المتبادل بين الخلايا المناعية التكيفية والفطرية أثناء تطور سرطان الثدي. الدقة لسرطان الثدي 9 (4): 212. https://doi.org/10.1186/bcr1746

تقوم خلايا DeNardo DG، Barreto JB، Andreu P، Vasquez L، Tawfik D، Kolhatkar N، Coussens LM (2009) CD4 (+) T الخلايا بتنظيم النقائل الرئوية لسرطان الثدي عن طريق تعزيز خصائص الخلايا الضامة الأولية. الخلية السرطانية 16 (2): 91-102. https://doi.org/10.1016/j.ccr.2009.06.018

Dirat B، Bochet L، Dabek M، Daviaud D، Dauvillier S، Majed B، Wang YY، Meulle A، Salles B، Le Gonidec S، Garrido I، Escourrou G، Valet P، Muller C (2011) معرض الخلايا الشحمية المرتبطة بالسرطان النمط الظاهري المنشط ويساهم في غزو سرطان الثدي. دقة السرطان 71 (7): 2455-2465. https://doi.org/10.1158/0008-5472.CAN-10-3323

دوس سانتوس CO ، Rebbeck C ، Rozhkova E ، Valentine A ، Samuels A ، Kadiri LR ، Osten P ، Harris EY ، Uren PJ ، Smith AD ، Hannon GJ (2013) التسلسل الهرمي الجزيئي للتمايز الثديي ينتج عنه علامات محسنة للخلايا الجذعية الثديية. Proc Natl Acad Sci U S A 110 (18): 7123-7130. https://doi.org/10.1073/pnas.1303919110

Dravis C و Chung CY و Lytle NK و Herrera-Valdez J و Luna G و Trejo CL و Reya T و Wahl GM (2018) يكشف التنميط اللاجيني والنسخ لتطور الغدة الثديية ونماذج الورم عن منظمات لدونة حالة الخلية. الخلية السرطانية 34 (3): 466-482 e466. https://doi.org/10.1016/j.ccell.2018.08.001

Duncan JS، Whittle MC، Nakamura K، Abell AN، Midland AA، Zawistowski JS، Johnson NL، Granger DA، Jordan NV، Darr DB، Usary J، Kuan PF، Smalley DM، Major B، He X، Hoadley KA، Zhou B ، Sharpless NE ، Perou CM ، Kim WY ، Gomez SM ، Chen X ، Jin J ، Frye SV ، Earp HS ، Graves LM ، Johnson GL (2012) إعادة البرمجة الديناميكية للكينوم استجابةً لتثبيط مجاهدي خلق المستهدف في سرطان الثدي الثلاثي السلبي . الخلية 149 (2): 307-321. https://doi.org/10.1016/j.cell.2012.02.053

Duong MN، Geneste A، Fallone F، Li X، Dumontet C، Muller C (2017) الدهون والسيئة: الخلايا الشحمية الناضجة ، الجهات الفاعلة الرئيسية في تطور الورم ومقاومته. Oncotarget 8 (34): 57622-57641. https://doi.org/10.18632/oncotarget.18038

Edechi CA، Ikeogu N، Uzonna JE، Myal Y (2019) تنظيم المناعة في سرطان الثدي. السرطان (بازل). https://doi.org/10.3390/cancers11081080

Egeblad M، Rasch MG، Weaver VM (2010) تفاعل ديناميكي بين سقالة الكولاجين وتطور الورم. خلية العملة المفتوحة بيول 22 (5): 697-706. https://doi.org/10.1016/j.ceb.2010.08.015

Fang F ، Turcan S ، Rimner A ، Kaufman A ، Giri D ، Morris LG ، Shen R ، Seshan V ، Mo Q ، Heguy A ، Baylin SB ، Ahuja N ، Viale A ، Massague J ، Norton L ، Vahdat LT ، Moynahan ME ، Chan TA (2011) ميثيلوم سرطان الثدي يؤسس الأساس اللاجيني للورم الخبيث. Sci Transl Med 3 (75): 75ra25

Fantozzi A ، Christofori G (2006) نماذج فأر لورم خبيث لسرطان الثدي. الدقة لسرطان الثدي 8 (4): 212. https://doi.org/10.1186/bcr1530

Feeley LP أو Mulligan AM أو Pinnaduwage D أو Bull SB أو Andrulis IL (2014) يوفر التمييز بين الأنواع الفرعية لسرطان الثدي اللمعي بواسطة Ki67 أو مستقبلات البروجسترون أو حالة TP53 معلومات تنبؤية. مود باثول 27 (4): 554-561. https://doi.org/10.1038/modpathol.2013.153

Fitzgibbons PL، Page DL، Weaver D، Thor AD، Allred DC، Clark GM، Ruby SG، O'Malley F، Simpson JF، Connolly JL، Hayes DF، Edge SB، Lichter A، Schnitt SJ (2000) سرطان. بيان إجماع الكلية الأمريكية لعلماء الأمراض 1999. Arch Pathol Lab Med 124 (7): 966-978

Forouzanfar MH، Foreman KJ، Delossantos AM، Lozano R، Lopez AD، Murray CJ، Naghavi M (2011) سرطان الثدي وعنق الرحم في 187 دولة بين 1980 و 2010: تحليل منهجي. لانسيت 378 (9801): 1461–1484. https://doi.org/10.1016/S0140-6736(11)61351-2

Fuseler JW ، Robichaux JP ، Atiyah HI ، Ramsdell AF (2014) يحدد تحليل البعد المورفومتري والفركتلي التغيرات الورمية المبكرة في الظهارة الثديية لفئران MMTV-cNeu. مضاد للسرطان 34 (3): 1171-1177

Gamba CO، Damasceno KA، Ferreira IC، Rodrigues MA، Gomes DA، Alves MR، Rocha RM، Lima AE، Ferreira E، Cassali GD (2019) التحقيق في قمع النسخ بوساطة ZEB2 في سرطان الحبيبات الدقيقة الغازية للكلاب في الغدة الثديية. بلوس واحد 14 (1): e0209497. https://doi.org/10.1371/journal.pone.0209497

Garrido-Castro AC، Lin NU، Polyak K (2019) نظرة ثاقبة في التصنيفات الجزيئية لسرطان الثدي الثلاثي السلبي: تحسين اختيار المريض للعلاج. اكتشاف السرطان 9 (2): 176-198. https://doi.org/10.1158/2159-8290.CD-18-1177

Gasco M، Shami S، Crook T (2002) مسار p53 في سرطان الثدي. الدقة سرطان الثدي 4 (2): 70-76. https://doi.org/10.1186/bcr426

Georgess D، Padmanaban V، Sirka OK، Coutinho K، Choi A، Frid G، Neumann NM، Inoue T، Ewald AJ (2020) يتطلب النشر الظهاري الناجم عن Twist1 إشارة Prkd1. الدقة السرطان 80 (2): 204-218. https://doi.org/10.1158/0008-5472.CAN-18-3241

Gil Del Alcazar CR، Huh SJ، Ekram MB، Trinh A، Liu LL، Beca F، Zi X، Kwak M، Bergholtz H، Su Y، Ding L، Russnes HG، Richardson AL، Babski K، Min Hui Kim E، McDonnell CH 3rd ، Wagner J ، Rowberry R ، Freeman GJ ، Dillon D ، Sorlie T ، Coussens LM ، Garber JE ، Fan R ، Bobolis K ، Allred DC ، Jeong J ، Park SY ، Michor F ، Polyak K (2017) سرطان الثدي أثناء انتقال السرطان من الموقع إلى الغازية. اكتشاف السرطان 7 (10): 1098-1115. https://doi.org/10.1158/2159-8290.CD-17-0222

Giles ED ، Wellberg EA (2020) نماذج ما قبل السريرية لدراسة السمنة وسرطان الثدي لدى الإناث: الاعتبارات والمحاذير والأدوات. J Mammary Gland Biol Neoplasia 25 (4): 237-253. https://doi.org/10.1007/s10911-020-09463-2

Goonewardene TI ، Sowter HM ، Harris AL (2002) المسارات التي يسببها نقص الأكسجة في سرطان الثدي. تقنية الدقة المجهرية 59 (1): 41-48. https://doi.org/10.1002/jemt.10175

Grove E ، Eckardt S ، McLaughlin KJ (2016) الفأر عالي السرعة يتقاطع مع خط جرثومة الإناث. بلوس واحد 11 (12): e0166822. https://doi.org/10.1371/journal.pone.0166822

Guerrini L، Costanzo A، Merlo GR (2011) سيمفونية من اللوائح تركز على p63 للتحكم في تطوير الهياكل المشتقة من الأديم الظاهر. J Biomed Biotechnol 2011: 864904. https://doi.org/10.1155/2011/864904

Hammond ME، Hayes DF، Dowsett M، Allred DC، Hagerty KL، Badve S، Fitzgibbons PL، Francis G، Goldstein NS، Hayes M، Hicks DG، Lester S، Love R، Mangu PB، McShane L، Miller K، Osborne CK ، Paik S، Perlmutter J، Rhodes A، Sasano H، Schwartz JN، Sweep FC، Taube S، Torlakovic EE، Valenstein P، Viale G، Visscher D، Wheeler T، Williams RB، Wittliff JL، Wolff AC (2010) American Society توصيات توجيهية لعلم الأورام السريري / كلية علماء الأمراض الأمريكية للاختبار الكيميائي المناعي لمستقبلات هرمون الاستروجين والبروجسترون في سرطان الثدي. ياء كلين أونكول 28 (16): 2784-2795. https://doi.org/10.1200/JCO.2009.25.6529

Hanahan D، Weinberg RA (2011) السمات المميزة للسرطان: الجيل القادم. الخلية 144 (5): 646-674. https://doi.org/10.1016/j.cell.2011.02.013

Harbeck N و Penault-Llorca F و Cortes J و Gnant M و Houssami N و Poortmans P و Ruddy K و Tsang J و Cardoso F (2019) سرطان الثدي. Nat Rev Dis Primers 5 (1): 66. https://doi.org/10.1038/s41572-019-0111-2

Hasebe T، Tsuda H، Hirohashi S، Shimosato Y، Iwai M، Imoto S، Mukai K (1996) التركيز الليفي في سرطان الأقنية الغازية: مؤشر على شدة الورم الشديدة. Jpn J Cancer Res 87 (4): 385–394. https://doi.org/10.1111/j.1349-7006.1996.tb00234.x

Hasebe T، Tsuda H، Hirohashi S، Shimosato Y، Tsubono Y، Yamamoto H، Mukai K (1998) التركيز الليفي في تسلل سرطان الأقنية للثدي: معلمة تنبؤية تشريح مرضي مهمة للتنبؤ ببقاء المرضى على المدى الطويل. علاج الدقة لسرطان الثدي 49 (3): 195-208. https://doi.org/10.1023/a:1006067513634

He D، Mustafi D، Fan X، Fernandez S، Markiewicz E، Zamora M، Mueller J، Sachleben JR، Brady MJ، Conzen SD، Karczmar GS (2018) يكتشف التحليل الطيفي بالرنين المغناطيسي تكوين الدهون التفاضلية في الغدد الثديية على نسبة منخفضة من الدهون ومرتفعة الدهون الحيوانية مقابل النظم الغذائية عالية الفركتوز. بلوس واحد 13 (1): e0190929. https://doi.org/10.1371/journal.pone.0190929

Heilmann K، Toth R، Bossmann C، Klimo K، Plass C، Gerhauser C (2017) شاشة الجينوم الواسعة للـ RNAs طويلة الميثيل غير المشفرة تفاضليًا تحدد Esrp2 و lncRNA Esrp2- كما ينظمها مثيلة الحمض النووي المحسن مع أهمية الإنذار لسرطان الثدي البشري. الجين الورمي 36 (46): 6446-6461. https://doi.org/10.1038/onc.2017.246

Holen I و Speirs V و Morrissey B و Blyth K (2017) في النماذج المجراة في أبحاث سرطان الثدي: التقدم والتحديات والاتجاهات المستقبلية. Dis Model Mech 10 (4): 359–371. https://doi.org/10.1242/dmm.028274

Hollern DP ، Andrechek ER (2014) يكشف التحليل الجيني لنماذج الفئران لسرطان الثدي عن السمات الجزيئية لنماذج الفئران والعلاقات مع سرطان الثدي البشري. الدقة لسرطان الثدي 16 (3): R59. https://doi.org/10.1186/bcr3672

Hou Z، Zhang Y (2019) إدخال الحمض النووي باستخدام كريسبر. Science 365 (6448): 25-26. https://doi.org/10.1126/science.aay2056

خلايا Huang Y و Ma C و Zhang Q و Ye J و Wang F و Zhang Y و Hunborg P و Varvares MA و Hoft DF و Hsueh EC و Peng G (2015) CD4 + و CD8 + T لها أدوار متعارضة في تطور سرطان الثدي ونتائجه. Oncotarget 6 (19): 17462-17478. https://doi.org/10.18632/oncotarget.3958

Khan JA، Mendelson A، Kunisaki Y، Birbrair A، Kou Y، Arnal-Estape A، Pinho S، Ciero P، Nakahara F، Ma'ayan A، Bergman A، Merad M، Frenette PS (2016) الخلايا الجذعية المكونة للدم في كبد الجنين المنافذ المرتبطة بأوعية البوابة. العلوم 351 (6269): 176-180. https://doi.org/10.1126/science.aad0084

Korinek V (2020) إصدار خاص: النمذجة الحيوانية في السرطان. الجينات (بازل) https://doi.org/10.3390/genes11091009

Koyama T، Hasebe T، Tsuda H، Hirohashi S، Sasaki S، Fukutomi T، Imoto S، Umeda T، Mukai K (1999) العوامل النسيجية المرتبطة بنقائل العظام الأولية لسرطان الثدي القنوي الغازي. Jpn J Cancer Res 90 (3): 294-300. https://doi.org/10.1111/j.1349-7006.1999.tb00747.x

Kriegsmann M و Endris V و Wolf T و Pfarr N و Stenzinger A و Loibl S و Denkert C و Schneeweiss A و Budczies J و Sinn P و Weichert W (2014) تظهر ملامح الطفرات في سرطان الثدي الثلاثي السلبي المحدد من خلال التسلسل متعدد الجينات فائق الدقة مرتفعًا معدلات تعديلات مسار PI3K والاختلافات المحددة للمجموعة الفرعية للكيانات ذات الصلة سريريًا. Oncotarget 5 (20): 9952-9965. https://doi.org/10.18632/oncotarget.2481

Lengyel E ، Makowski L ، DiGiovanni J ، Kolonin MG (2018) السرطان بسبب الدهون: الحديث المتبادل بين الأنسجة الدهنية والأورام. اتجاهات السرطان 4 (5): 374-384. https://doi.org/10.1016/j.trecan.2018.03.004

Lester SC، Bose S، Chen YY، Connolly JL، de Baca ME، Fitzgibbons PL، Hayes DF، Kleer C، O'Malley FP، Page DL، Smith BL، Tan LK، Weaver DL، Winer E، أعضاء لجنة السرطان بروتوكول CoAP (2009) لفحص عينات من مرضى سرطان الثدي الغازي. قوس باثول لاب ميد 133 (10): 1515-1538. https://doi.org/10.1043/1543-2165-133.10.1515

Liao D ، Luo Y ، Markowitz D ، Xiang R ، Reisfeld RA (2009) تعزز الخلايا الليفية المرتبطة بالسرطان نمو الورم والورم الخبيث عن طريق تعديل البيئة المناعية للورم في نموذج سرطان الثدي 4T1. بلوس واحد 4 (11): e7965. https://doi.org/10.1371/journal.pone.0007965

Linder CC (2006) المتغيرات الجينية التي تؤثر على النمط الظاهري. ILAR J 47 (2): 132-140. https://doi.org/10.1093/ilar.47.2.132

Liu ML ، Von Lintig FC ، Liyanage M ، Shibata MA ، Jorcyk CL ، Ried T ، Boss GR ، Green JE (1998) تضخيم Ki-ras ورفع نشاط MAP kinase أثناء تقدم الورم الثديي في علامة C3 (1) / SV40 الفئران المعدلة وراثيا. الجين الورمي 17 (18): 2403-2411. https://doi.org/10.1038/sj.onc.1202456

Liu R ، Varghese S ، Rabkin SD (2005) علاج ناقل فيروس الهربس البسيط من سرطان الثدي في الفئران المعدلة وراثيًا C3 (1) / SV40 T-antigen. دقة السرطان 65 (4): 1532-1540. https://doi.org/10.1158/0008-5472.CAN-04-3353

Lonning PE (2007) التشخيص والتنبؤ بسرطان الثدي: هل نحرز تقدمًا؟ آن أونكول 18 (ملحق 8): viii3-7. https://doi.org/10.1093/annonc/mdm260

MacLennan MB ، Anderson BM ، Ma DW (2011) تطور الغدة الثديية التفاضلية في الفئران FVB و C57Bl / 6: الآثار المترتبة على أبحاث سرطان الثدي. العناصر الغذائية 3 (11): 929-936. https://doi.org/10.3390/nu3110929

Markel P، Shu P، Ebeling C، Carlson GA، Nagle DL، Smutko JS، Moore KJ (1997) قضايا نظرية وتجريبية لتربية سلالات الفئران المتجانسة بمساعدة الواسمات. نات جينيه 17 (3): 280-284. https://doi.org/10.1038/ng1197-280

Maroulakou IG، Anver M، Garrett L، Green JE (1994) سرطان البروستات والثدي في الفئران المعدلة وراثيا التي تحمل جرذ C3 (1) القرد الفيروس 40 جينة اندماج مستضد الورم الكبير. Proc Natl Acad Sci U S A 91 (23): 11236-11240

Martin-Pardillos A و Valls Chiva A و Bande Vargas G و Hurtado Blanco P و Pineiro Cid R و Guijarro PJ و Hummer S و Bejar Serrano E و Rodriguez-Casanova A و Diaz-Lagares A و Castellvi J و Miravet-Verde S و Serrano L ، Lluch-Senar M ، Sebastian V ، Bribian A ، Lopez-Mascaraque L ، Lopez-Lopez R ، Ramon YCS (2019) دور التواصل النسيلي وعدم التجانس في سرطان الثدي. سرطان BMC 19 (1): 666. https://doi.org/10.1186/s12885-019-5883-y

Maughan KL ، Lutterbie MA ، Ham PS (2010) علاج سرطان الثدي. طبيب فام 81 (11): 1339-1346

McPhail LD ، Robinson SP (2010) القابلية الجوهرية للتصوير بالرنين المغناطيسي لأورام الفئران الثديية المستحثة كيميائياً: العلاقة بالتقييم النسيجي لنقص الأكسجة والتليف. الأشعة 254 (1): 110-118. https://doi.org/10.1148/radiol.2541090395

Medri L ، Volpi A ، Nanni O ، Vecci AM ، Mangia A ، Schittulli F ، Padovani F ، Giunchi DC ، Zito A ، Amadori D ، Paradiso A ، Silvestrini R (2003) الأهمية التنبؤية للنشاط الانقسامي في المرضى الذين يعانون من ثدي سلبي للعقد سرطان. مود باثول 16 (11): 1067-1075. https://doi.org/10.1097/01.MP.0000093625.20366.9D

Meyer-Losic F ، Newman SP ، Day JM ، Reed MJ ، Kasprzyk PG ، Purohit A ، Foster PA (2013) STX140 ، ولكن ليس باكليتاكسيل ، يمنع بدء ورم الثدي وتطوره في C3 (1) / SV40 T / t-antigen transgenic الفئران. بلوس واحد 8 (12): e80305. https://doi.org/10.1371/journal.pone.0080305

Nissen NI و Karsdal M و Willumsen N (2019) Collagens والأرومات الليفية المرتبطة بالسرطان في السدى التفاعلي وعلاقته ببيولوجيا السرطان. J Exp Clin Cancer Res 38 (1): 115. https://doi.org/10.1186/s13046-019-1110-6

Nobre AR و Risson E و Singh DK و Martino JD و Cheung JF و Wang J و Johnson J و Russnes HG و Bravo-Cordero JJ و Birbrair A و Naume B و Azhar M و Frenette PS و Aguirre-Ghiso J (2021) نخاع العظام NG2 + / Nestin + الخلايا الجذعية الوسيطة تدفع DTC إلى السكون عبر TGFβ2. سرطان الطبيعة 2: 327-339

Ognjenovic NB، Bagheri M، Mohamed GA، Xu K، Chen Y، Mohamed Saleem MA، Brown MS، Nagaraj SH، Muller KE، Gerber SA، Christensen BC، Pattabiraman DR (2020) الحد من التجديد الذاتي للمقصورة القاعدية بواسطة تنشيط PKA يستحث التمايز ويغير تطور أورام الثدي. Dev Cell 55 (5): 544-557 e546. https://doi.org/10.1016/j.devcel.2020.10.004

O'Toole SA، Machalek DA، Shearer RF، Millar EK، Nair R، Schofield P، McLeod D، Cooper CL، McNeil CM، McFarland A، Nguyen A، Ormandy CJ، Qiu MR، Rabinovich B، Martelotto LG، Vu D، Hannigan GE ، Musgrove EA ، Christ D ، Sutherland RL ، Watkins DN ، Swarbrick A (2011) يرتبط تعبير Hedgehog المفرط بالتفاعلات اللحمية والتنبؤ بالنتائج السيئة في سرطان الثدي. مقاومة السرطان 71 (11): 4002-4014. https://doi.org/10.1158/0008-5472.CAN-10-3738

Padmanaban V ، Krol I ، Suhail Y ، Szczerba BM ، Aceto N ، Bader JS ، Ewald AJ (2019) مطلوب E-cadherin للورم الخبيث في نماذج متعددة من سرطان الثدي. طبيعة 573 (7774): 439-444. https://doi.org/10.1038/s41586-019-1526-3

Park J، Wysocki RW، Amoozgar Z، Maiorino L، Fein MR، Jorns J، Schott AF، Kinugasa-Katayama Y، Lee Y، Won NH، Nakasone ES، Hearn SA، Kuttner V، Qiu J، Almeida AS، Perurena N، Kessenbrock K، Goldberg MS، Egeblad M (2016) تحفز الخلايا السرطانية مصائد الحمض النووي خارج الخلية الداعمة للورم الخبيث. Sci Transl Med 8 (361): 361ra138. https://doi.org/10.1126/scitranslmed.aag1711

Park MK ، Lee CH ، Lee H (2018) نماذج الفئران لسرطان الثدي في الأبحاث قبل السريرية. Lab Anim Res 34 (4): 160–165. https://doi.org/10.5625/lar.2018.34.4.160

Pathania R، Ramachandran S، Elangovan S، Padia R، Yang P، Cinghu S، Veeranan-Karmegam R، Arjunan P، Gnana-Prakasam JP، Sadanand F، Pei L، Chang CS، Choi JH، Shi H، Manicassamy S، Prasad PD، Sharma S، Ganapathy V، Jothi R، Thangaraju M (2015) DNMT1 ضروري لصيانة الخلايا الجذعية السرطانية والثديية وتكوين الأورام. نات كومون 6: 6910. https://doi.org/10.1038/ncomms7910

Perou CM، Sorlie T، Eisen MB، van de Rijn M، Jeffrey SS، Rees CA، Pollack JR، Ross DT، Johnsen H، Akslen LA، Fluge O، Pergamenschikov A، Williams C، Zhu SX، Lonning PE، Borresen-Dale AL، Brown PO، Botstein D (2000) صور جزيئية لأورام الثدي البشرية. طبيعة 406 (6797): 747-752. https://doi.org/10.1038/35021093

Petruzzelli M، Schweiger M، Schreiber R، Campos-Olivas R، Tsoli M، Allen J، Swarbrick M، Rose-John S، Rincon M، Robertson G، Zechner R، Wagner EF (2014) التبديل من زيادة الدهون البيضاء إلى البنية إنفاق الطاقة في دنف مرتبط بالسرطان. الخلية Metab 20 (3): 433-447. https://doi.org/10.1016/j.cmet.2014.06.011

Pfefferle AD، Herschkowitz JI، Usary J، Harrell JC، Spike BT، Adams JR، Torres-Arzayus MI، Brown M، Egan SE، Wahl GM، Rosen JM، Perou CM (2013) يحدد نظرائهم من النوع الفرعي البشري. جينوم بيول 14 (11): R125. https://doi.org/10.1186/gb-2013-14-11-r125

Pietilainen T ، Lipponen P ، Aaltomaa S ، Eskelinen M ، Kosma VM ، Syrjanen K (1996) القيمة التنبؤية الهامة لتعبير Ki-67 كما هو محدد بواسطة تحليل الصور في سرطان الثدي. ي السرطان ريس كلين أونكول 122 (11): 687-692. https://doi.org/10.1007/BF01209033

Prazeres P و Leonel C و Silva WN و Rocha BGS و Santos GSP و Costa AC و Picoli CC و Sena IFG و Goncalves WA و Vieira MS و Costa PAC و Campos L و Lopes MTP و Costa MR و Resende RR و Cunha TM و Mintz A ، Birbrair A (2020a) استئصال الأعصاب الحسية يساعد على تطور الورم الميلانيني. J سيل مول ميد. https://doi.org/10.1111/jcmm.15381

Prazeres P و Leonel C و Silva WN و Rocha BGS و Santos GSP و Costa AC و Picoli CC و Sena IFG و Goncalves WA و Vieira MS و Costa PAC و Campos L و Lopes MTP و Costa MR و Resende RR و Cunha TM و Mintz A ، Birbrair A (2020b) استئصال الأعصاب الحسية يساعد على تطور الورم الميلانيني. J Cell Mol Med 24 (17): 9574-9589. https://doi.org/10.1111/jcmm.15381

Quail DF، Dannenberg AJ (2019) البيئة الدقيقة للأنسجة الدهنية السمنة في تطور السرطان وتطوره. نات ريف إندوكرينول 15 (3): 139-154. https://doi.org/10.1038/s41574-018-0126-x

Rivera J ، Tessarollo L (2008) الخلفية الجينية ومعضلة ترجمة دراسات الفئران إلى البشر. مناعة 28 (1): 1-4. https://doi.org/10.1016/j.immuni.2007.12.008

روبرتس بي جيه ، يوساري جي ، دار دي بي ، ديلون بيإم ، بفيفيرل إيه دي ، ويتل إم سي ، دنكان جي إس ، جونسون إس إم ، كومبيست إيه جيه ، جين جي ، زامبوني دبليو سي ، جونسون جي إل ، بيرو سم ، شاربلس إن إي (2012) جمعت بين PI3K / mTOR و MEK يوفر التثبيط نشاطًا واسعًا مضادًا للورم في نماذج سرطان الفئران المؤمنة. كلين كانسر ريس 18 (19): 5290-5303. https://doi.org/10.1158/1078-0432.CCR-12-0563

Ronnov-Jessen L ، Petersen OW ، Bissell MJ (1996) التغيرات الخلوية المتضمنة في تحويل الثدي الطبيعي إلى الخبيث: أهمية رد الفعل اللحمي. فيسيول القس 76 (1): 69-125. https://doi.org/10.1152/physrev.1996.76.1.69

Ross C و Szczepanek K و Lee M و Yang H و Peer CJ و Kindrick J و Shankarappa P و Lin ZW و Sanford JD و Figg WD ​​و Hunter KW (2020) التعبير الجيني الخاص بالورم الخبيث في نماذج الأورام الثديية الذاتية والطعم الخيفي: التقسيم الطبقي وتحديد التوقيعات المستهدفة. الدقة المولية للسرطان 18 (9): 1278-1289. https://doi.org/10.1158/1541-7786.MCR-20-0046

تصفح GJ ، Ritland SR ، Gendler SJ (1998) التعديل الجيني لتكوين الأورام الثديية المستحثة بالجينات الورمية الجديدة. دقة السرطان 58 (12): 2675-2679

Ruffell B، Chang-Strachan D، Chan V، Rosenbusch A، Ho CM، Pryer N، Daniel D، Hwang ES، Rugo HS، Coussens LM (2014) Macrophage IL-10 يحجب الاستجابات المعتمدة على الخلايا CD8 + T للعلاج الكيميائي عن طريق قمع IL -12 التعبير في الخلايا التغصنية داخل الورم. الخلية السرطانية 26 (5): 623-637. https://doi.org/10.1016/j.ccell.2014.09.006

ساكاموتو ك ، شميدت جي دبليو ، واغنر كو (2015) نماذج فأر لسرطان الثدي. طرق Mol Biol 1267: 47-71. https://doi.org/10.1007/978-1-4939-2297-0_3

Salgado R، Denkert C، Demaria S، Sirtaine N، Klauschen F، Pruneri G، Wienert S، Van den Eynden G، Baehner FL، Penault-Llorca F، Perez EA، Thompson EA، Symmans WF، Richardson AL، Brock J، Criscitiello C، Bailey H، Ignatiadis M، Floris G، Sparano J، Kos Z، Nielsen T، Rimm DL، Allison KH، Reis-Filho JS، Loibl S، Sotiriou C، Viale G، Badve S، Adams S، Willard-Gallo K ، Loi S ، International TWG (2015) تقييم الخلايا الليمفاوية المتسللة إلى الورم (TILs) في سرطان الثدي: توصيات من مجموعة عمل TILs الدولية 2014. Ann Oncol 26 (2): 259-271. https://doi.org/10.1093/annonc/mdu450

Sellers RS ، Clifford CB ، Treuting PM ، Brayton C (2012) التباين المناعي بين سلالات الفئران المختبرية الفطرية: نقاط يجب مراعاتها في التنميط الظاهري للفئران المعدلة وراثيًا. بيطري باثول 49 (1): 32-43. https://doi.org/10.1177/0300985811429314

Shay T و Jojic V و Zuk O و Rothamel K و Puyraimond-Zemmour D و Feng T و Wakamatsu E و Benoist C و Koller D و Regev A و ImmGen C (2013) الحفظ والتباعد في برامج النسخ لمناعة الإنسان والفأر الأنظمة. Proc Natl Acad Sci U S A 110 (8): 2946-2951. https://doi.org/10.1073/pnas.1222738110

Shibata MA ، Maroulakou IG ، Jorcyk CL ، Gold LG ، Ward JM ، Green JE (1996) p53 - موت الخلايا المبرمج المستقل أثناء تطور ورم الثدي في الفئران المعدلة وراثيًا C3 (1) / SV40 كبيرة T مستضد T: قمع موت الخلايا المبرمج أثناء الانتقال من مرحلة ما قبل التنسج إلى سرطان. الدقة السرطان 56 (13): 2998-3003

شيباتا MA ، Jorcyk CL ، Liu ML ، Yoshidome K ، Gold LG ، Green JE (1998) نموذج الماوس المعدّل وراثيًا C3 (1) / SV40 T لسرطان البروستاتا والثدي. توكسيكول باثول 26 (1): 177-182. https://doi.org/10.1177/019262339802600121

سينغ بي ، شيمنتي جي سي ، بولكون-فيلاس إي (2015) دليل عملي لعالم وراثة الفئران لتطبيقات كريسبر. علم الوراثة 199 (1): 1-15. https://doi.org/10.1534/genetics.114.169771

Sohail A، Khan A، Wahab N، Zameer A، Khan S (2021) إطار عمل للكشف عن الانقسام متعدد المراحل قائم على شبكة CNN للصور النسيجية لسرطان الثدي. ممثل العلوم 11 (1): 6215. https://doi.org/10.1038/s41598-021-85652-1

Song HK ، Hwang DY (2017) استخدام الفئران C57BL / 6N في مجموعة متنوعة من الأبحاث المناعية. Lab Anim Res 33 (2): 119-123. https://doi.org/10.5625/lar.2017.33.2.119

Song W ، Hwang Y ، Youngblood VM ، Cook RS ، Balko JM ، Chen J ، Brantley-Sieders DM (2017) استهداف EphA2 يضعف تقدم دورة الخلية ونمو سرطانات الثدي الشبيهة بالقاعدة / السلبية الثلاثية. الجين الورمي 36 (40): 5620-5630. https://doi.org/10.1038/onc.2017.170

Souza CM، Gamba Cde O، Campos CB، Lopes MT، Ferreira MA، Andrade SP، Cassali GD (2013) Carboplatin يؤخر نمو سرطان الثدي 4T1 في الفئران. ممارسة Pathol Res Practice 209 (1): 24–29. https://doi.org/10.1016/j.prp.2012.10.003

Sundaram S ، Freemerman AJ ، Galanko JA ، McNaughton KK ، Bendt KM ، Darr DB ، Troester MA ، Makowski L (2014) يرتبط تنظيم HGF / c-Met بوساطة السمنة بانخفاض زمن انتقال سرطان الثدي الشبيه بالقاعدي في الفئران الوليدة. بلوس واحد 9 (10): e111394. https://doi.org/10.1371/journal.pone.0111394

Takao K، Miyakawa T (2015) الاستجابات الجينومية في نماذج الفئران تحاكي بشكل كبير الأمراض الالتهابية البشرية. Proc Natl Acad Sci U S A 112 (4): 1167-1172. https://doi.org/10.1073/pnas.1401965111

Taketo M و Schroeder AC و Mobraaten LE و Gunning KB و Hanten G و Fox RR و Roderick TH و Stewart CL و Lilly F و Hansen CT et al (1991) FVB / N: سلالة فئران فطرية مفضلة للتحليلات المعدلة وراثيًا. بروك ناتل أكاد سسي يو إس إيه 88 (6): 2065-2069. https://doi.org/10.1073/pnas.88.6.2065

Tatum JL، Kelloff GJ، Gillies RJ، Arbeit JM، Brown JM، Chao KS، Chapman JD، Eckelman WC، Fyles AW، Giaccia AJ، Hill RP، Koch CJ، Krishna MC، Krohn KA، Lewis JS، Mason RP، Melillo G ، Padhani AR، Powis G، Rajendran JG، Reba R، Robinson SP، Semenza GL، Swartz HM، Vaupel P، Yang D، Croft B، Hoffman J، Liu G، Stone H، Sullivan D (2006) Hypoxia: الأهمية في الورم علم الأحياء ، والقياس غير الباضع عن طريق التصوير ، وقيمة قياسه في إدارة علاج السرطان. إنت J Radiat Biol 82 (10): 699-757. https://doi.org/10.1080/09553000601002324

Teixido J، Hidalgo A، Fagerholm S (2019) الافتتاحية: الاتجار في الكريات البيض في الاستتباب والمرض. إمونول أمامي 10: 2560. https://doi.org/10.3389/fimmu.2019.02560

Tiwari P، Blank A، Cui C، Schoenfelt KQ، Zhou G، Xu Y، Khramtsova G، Olopade F، Shah AM، Khan SA، Rosner MR، Becker L (2019) تربط الضامة الأنسجة الدهنية المنشطة الأيضية السمنة بالثدي الثلاثي السلبي سرطان. J Exp Med 216 (6): 1345–1358. https://doi.org/10.1084/jem.20181616

Van den Eynden GG، Colpaert CG، Couvelard A، Pezzella F، Dirix LY، Vermeulen PB، Van Marck EA، Hasebe T (2007) التركيز الليفي هو عامل تنبؤي وعلامة بديلة لنقص الأكسجة وتكوين الأوعية (الليمفاوية) في سرطان الثدي : مراجعة الأدبيات واقتراح معايير التقييم. علم التشريح المرضي 51 (4): 440-451. https://doi.org/10.1111/j.1365-2559.2007.02761.x

van Diest PJ، Baak JP، Matze-Cok P، Wisse-Brekelmans EC، van Galen CM، Kurver PH، Bellot SM، Fijnheer J، van Gorp LH، Kwee WS et al (1992) قابلية استنساخ العد الانقسام في 2469 عينة من سرطان الثدي : نتائج مشروع سرطان الثدي المورفومتري متعدد المراكز. هموم باثول 23 (6): 603-607. https://doi.org/10.1016/0046-8177(92)90313-r

van Diest PJ، Brugal G، Baak JP (1998) علامات الانتشار في الأورام: التفسير والقيمة السريرية. ياء كلين باثول 51 (10): 716-724. https://doi.org/10.1136/jcp.51.10.716

Vandeweyer E ، Hertens D (2002) القياس الكمي للغدد والدهون في أنسجة الثدي: تحديد تجريبي. آن عنات 184 (2): 181-184. https://doi.org/10.1016/S0940-9602(02)80016-4

Vitosevic K، Todorovic M، Varljen T، Slovic Z، Matic S، Todorovic D (2018) تأثير تثبيت الفورمالين على تضخيم تفاعل البوليميراز المتسلسل للحمض النووي المعزول من أنسجة التشريح الصحية. اكتا هيستوشيم 120 (8): 780-788. https://doi.org/10.1016/j.acthis.2018.09.005

Wagner KU (2004) نماذج سرطان الثدي: quo vadis ، النمذجة الحيوانية؟ الدقة لسرطان الثدي 6 (1): 31-38. https://doi.org/10.1186/bcr723

Weinstock A، Moura Silva H، Moore KJ، Schmidt AM، Fisher EA (2020) عدم تجانس الكريات البيض في الأنسجة الدهنية ، بما في ذلك السمنة. Circ Res 126 (11): 1590–1612. https://doi.org/10.1161/CIRCRESAHA.120.316203

Wetsel RA ، Fleischer DT ، Haviland DL (1990) نقص المكون التكميلي الخامس من الفئران (C5). حذف جيني ثنائي القاعدة في 5’-exon. J بيول كيم 265 (5): 2435-2440

Wild R ، Yokoyama Y ، Dings RP ، Ramakrishnan S (2004) VEGF-DT385 توكسين متقارن يمنع تطور سرطان الغدة الثديية في نموذج فأر معدّل وراثيًا لتكوين الأورام العفوية. علاج دقّة سرطان الثدي 85 (2): 161–171. https://doi.org/10.1023/B:BREA.0000025407.02896.ec

Wiseman BS، Werb Z (2002) التأثيرات اللحمية على نمو الغدة الثديية وسرطان الثدي. العلوم 296 (5570): 1046-1049. https://doi.org/10.1126/science.1067431

Wolff AC، Hammond ME، Hicks DG، Dowsett M، McShane LM، Allison KH، Allred DC، Bartlett JM، Bilous M، Fitzgibbons P، Hanna W، Jenkins RB، Mangu PB، Paik S، Perez EA، Press MF، Spears PA ، Vance GH، Viale G، Hayes DF، American Society of Clinical O، College of American P (2013) توصيات لاختبار مستقبل عامل نمو البشرة البشري 2 في سرطان الثدي: الجمعية الأمريكية لعلم الأورام السريري / كلية علماء الأمراض الأمريكية تحديث إرشادات الممارسة السريرية . J كلين أونكول 31 (31): 3997-4013. https://doi.org/10.1200/JCO.2013.50.9984

Yoshidome K ، Shibata MA ، Canrey C ، Korach KS ، Green JE (2000) يعزز الإستروجين تطور ورم الثدي في C3 (1) / SV40 الفئران الكبيرة المعدلة وراثيًا للمستضد T: فقدان متناقض لمستقبلات هرمون الاستروجين تعبير ألفا أثناء تقدم الورم. الدقة السرطان 60 (24): 6901-6910

Yoshiki A ، Moriwaki K (2006) أبحاث ظاهرية الفأر: آثار الخلفية الجينية. ILAR J 47 (2): 94-102. https://doi.org/10.1093/ilar.47.2.94

Zhu M و Yi M و Kim CH و Deng C و Li Y و Medina D و Stephens RM و Green JE (2011) يحدد التنميط المتكامل لتعبير ميرنا و mRNA لنماذج ورم ثديي الفأر توقيعات ميرنا المرتبطة بنسب ورم الثدي. جينوم بيول 12 (8): R77. https://doi.org/10.1186/gb-2011-12-8-r77

Zhu X و Chen L و Huang B و Wang Y و Ji L و Wu J و Di G و Liu G و Yu K و Shao Z و Wang Z (2020) الإمكانات التنبؤية والتنبؤية لـ Ki-67 في سرطان الثدي الثلاثي السلبي . Sci Rep 10 (1): 225. https://doi.org/10.1038/s41598-019-57094-3


المواد والأساليب

الفئران والخلايا المشتقة من BM وخطوط الخلايا

تم عزل خلايا الفئران أحادية النواة (MNCs) من PB أو من BM (تم مسحها من عظام الفخذ) من الإناث الخالية من مسببات الأمراض ، من 4 إلى 6 أسابيع من BALB / c-C3aR - / - الفئران 21 و C57B1 / 6 C3 - / - الفئران (مستعمرة تربية تم شراؤها من مختبر جاكسون ، بار هاربور ، مينيسوتا). تم استخدام 17 من النوع البري (بالوزن) C57Bl / 6 C3 + / + زملاء القمامة المطابقين للعمر والجنس التي تم تحديدها من خلال فحص مستويات بروتين C3 في المصل في مستعمرة C3 كعناصر تحكم في التجارب التي تفحص الفئران C3. تم إقران الفئران BALB / c-C3aR ، التي تم تهجينها لمدة 12 جيلًا إلى وزن الفئران BALB / c ، مع فئران BALB / c متطابقة مع العمر والجنس تم الحصول عليها من المعهد الوطني للسرطان (NCI) - فريدريك ( فريدريك ، دكتوراه في الطب). تم شراء الفئران الإضافية بالوزن C57Bl / 6 و BALB / c أيضًا من مختبر جاكسون. قبل التجربة ، تم تحديد النمط الظاهري لجميع الفئران من مستعمرة C3 عن طريق مقايسة مصل C3 (باستخدام الانتشار المناعي الشعاعي) ، وبالمثل تم استخدام تفاعل البلمرة المتسلسل (PCR) لتأكيد النمط الجيني لـ C3aR - / -. تم استنفاد الخلايا متعددة الجنسيات من الخلايا الملتصقة (A -) ثم تم تخصيبها من أجل MNCs ذات الكثافة الضوئية بواسطة الطرد المركزي Ficoll-Paque كما هو موصوف. تم عزل 22 خلية من خلايا Sca-1 + باستخدام حبات صغيرة مغناطيسية (Miltenyi Biotec ، Auburn ، CA) وفقًا لبروتوكول الشركة المصنعة. كان نقاء خلايا BM Sca-1 + المعزولة أكثر من 95 ٪ كما هو محدد بواسطة تحليل فارز الخلايا (FACS) باستخدام FACscan (BD Biosciences Immunocytometry Systems ، سان خوسيه ، كاليفورنيا). تم الحصول على الموافقة على الدراسة من مجلس المراجعة المؤسسية للجنة رعاية الحيوان والاستخدام بجامعة لويزفيل. تم تقديم الموافقة المستنيرة وفقًا لإعلان هلسنكي.

تم الحصول على خلايا BM ذات كثافة الضوء البشرية من متبرعين متطوعين أصحاء الذين أعطوا موافقة مستنيرة تمت الموافقة على البروتوكولات المستخدمة من قبل مجالس المراجعة المؤسسية لجامعة لويزفيل وجامعة جاجيلونيان. تم استنفاد الخلايا ذات الكثافة الضوئية من الخلايا الملتصقة والخلايا اللمفاوية التائية (A - T - MNCs) ، قبل تخصيبها لخلايا CD34 + عن طريق اختيار الانجذاب المناعي باستخدام خرز MiniMACS البارامغناطيسي (Miltenyi Biotec) كما هو موضح سابقًا. 23 كان نقاء خلايا BM CD34 + المعزولة أكثر من 98 ٪ على النحو المحدد باستخدام قياس التدفق الخلوي باستخدام FACscan.

اشتملت خطوط الخلايا المستخدمة في هذه الدراسة على خطوط الخلايا المكونة للدم K-562 و HL-60 و Jurkat ، والتي تم الحصول عليها من مجموعة الثقافة الأمريكية (Manassas ، VA) وتم استزراعها كما هو موصوف. 24

حشد الفئران

تمت تعبئة الفئران عن طريق الحقن تحت الجلد بمقدار 250 ميكروغرام / كجم من G-CSF البشري (Amgen ، Thousand Oaks ، CA) يوميًا لمدة 1 أو 3 أو 6 أيام. تم نزف الفئران من الضفيرة المدارية الرجعية للحصول على عدد الكريات البيض باستخدام Unopette Microcollection (Becton Dickinson ، Rutherford ، NJ) كما هو موصوف. 9،22 في 6 ساعات بعد آخر حقن G-CSF ، تم الحصول على PB من الوريد الأجوف (بإبرة قياس 25 وحقنة 1 مل تحتوي على 250 يو هيبارين) ومُخصب لـ MNCs ذات الكثافة الخفيفة كما هو موصوف. 22 في بعض بروتوكولات التعبئة ، تم حقن خصم C3aR المحدد SB 290157 داخل الصفاق (0.01-1 ميكروغرام / حيوان) كما هو موضح في أساطير الشكل. تم شراء SB 290157 من Calbiochem (سان دييغو ، كاليفورنيا) وأعيد تعليقه في محلول ملحي مخزّن بالفوسفات (PBS) / ثنائي ميثيل سلفوكسيد (DMSO) كما هو موصوف. 20

التدفق الخلوي

لتحديد كمية خلايا c-Kit / Sca-1 + ، تم إجراء تحليل قياس التدفق الخلوي ثنائي اللون. باختصار ، تم تلطيخ 50 ميكرولتر من الدم الكامل بكل من مضاد الفئران c-Kit fluorescein isothiocyanate (FITC) - متقارن ومضاد الفئران Sca-1 – Phycoerythrin (PE) - الأجسام المضادة أحادية النسيلة المقترنة (التركيز النهائي 1 ميكروغرام / مل من BD Biosciences Pharmingen ، سان دييغو ، كاليفورنيا). تم فحص العينات الملطخة بعناصر تحكم النظائر المناسبة (BD Biosciences Pharmingen) بالتوازي. بعد حضانة لمدة 20 دقيقة على الجليد ، تمت إضافة 2 مل من محلول FACS Lysing (أنظمة قياس المناعة المناعي BD Biosciences) لتحليل كريات الدم الحمراء. بعد ذلك تم غسل الخلايا مرتين في برنامج تلفزيوني ، وتعليقها في 0.3 مل من برنامج تلفزيوني ، وتحليلها بواسطة FACScan باستخدام برنامج CellQuest v.3.1 (أنظمة قياس المناعة المناعية BD Biosciences). عادةً ، تم الحصول على 20000 حدث وتم تحديد النسبة المئوية لخلايا c-Kit / Sca-1 + لمجموعة كريات الدم البيضاء بأكملها.

الكشف عن رواسب C3 في BM الفئران

تم تلطيخ خلايا BM Murine من الفئران C3 - / - وزملائها بالوزن بمزيج من بروتين بيريدينين كلوروفيل ألفا (PerCP) - سيانين 5 (Cy5) antimouse CD45 (BD Biosciences Pharmingen) وغلوبولين مناعي متعدد النسيلة المنقى من الماعز G ( IgG) antimouse C3 – Oregon Green (أدناه) عن طريق احتضان 1 × 10 6 خلايا في تخفيف مُحسَّن لـ Ab على الجليد لمدة 20 دقيقة ، متبوعًا بغسلتين في PBS وتعليق في 0.3 مل PBS. تم الحصول على البيانات وتحليلها عن طريق قياس التدفق الخلوي باستخدام برنامج FACscan و CellQuest v3.1 (Becton Dickinson ، San Jose ، CA). تم استخدام تلطيخ خلايا BM من C3 - / - الفئران كعنصر تحكم لأي تلطيخ غير محدد يمكن الحصول عليه باستخدام كاشف C3 المضاد للفئران متعدد النسيلة المنقى بتقارب (على سبيل المثال ، تلطيخ غير محدد للخلايا الميتة). تم إنشاء الجسم المضاد المنقى من التقارب (Ab) من جزء IgG من مصل الماعز المضاد للفأر C3 (Immunology Consultants ، Newberg ، OR) الذي تم عزله بواسطة كروماتوجراف سائل البروتين السريع لتبادل الأنيون Mono-Q (FPLC) متبوعًا بالامتصاص والشطف من الماوس C3-zymosan. باختصار ، تم تحضير زيموسان المطلي بـ C3 كما هو موصوف باستخدام 500 مجم زيموسان (Sigma Chemical ، St Louis ، MO) معلق في 11 مل من مصل الفأر الطازج وغسله 3 مرات باستخدام 1 M NaCl يحتوي على 0.1 ٪ deoxycholate الصوديوم (Sigma Chemical) لإزالة بروتينات مصل الفأر غير المرتبطة بشكل محدد. بعد غسل مرتين بمحلول ملحي فيرونال ، تم تكوير C3-zymosan بالطرد المركزي ، وعلق بالتساوي في 6 مل ماعز IgG anti-C3 (5 مجم / مل) باستخدام صوتنة قصيرة ، وحضنت أولاً عند 37 درجة مئوية لمدة 30 دقيقة ثم في 0 درجة مئوية لمدة 30 دقيقة مع خلط دوامة على فترات 10 دقائق لإبقاء C3-zymosan في وضع التعليق. لإزالة IgG غير المرتبط بشكل خاص ، تم غسل C3-zymosan 3 مرات مع PBS تم تسخينه إلى 37 درجة مئوية ثم 3 مرات باستخدام 1 M NaCl يحتوي على 0.1 ٪ deoxycholate الصوديوم تم تسخينه إلى 37 درجة مئوية. تمت إزالة Antimouse C3 IgG من C3-zymosan بالتعليق في 2 مل من هيدروكلوريد الجوانيدين 4-M والاحتضان عند 22 درجة مئوية لمدة 30 دقيقة. بعد تكوير C3-zymosan عن طريق الطرد المركزي ، تم غسيل المادة الطافية المحتوية على antimouse C3 المنقى بتقارب 3 مرات مقابل 1 L PBS عند 4 درجات مئوية. تم غسل C3-zymosan 3 مرات باستخدام PBS وتم تخزينها مجمدة عند -85 درجة مئوية لإعادة استخدامها في المستقبل. تم إقران antimouse C3 المُحلل إلى Oregon Green باستخدام مجموعة وضع العلامات على عمود الدوران وفقًا لبروتوكول الشركة المصنعة (مجسات جزيئية ، يوجين ، أو). تم تحديد التخفيف الأمثل لتلطيخ الخلايا المطلية بـ C3 باستخدام الخلايا السرطانية C3-opsonized الماوس وقياس التدفق الخلوي وتم استخدام هذا التخفيف لتلوين خلايا BM.

SB 290157 دراسات السمية

بالنسبة لتكاثر الخلايا / فحوصات البقاء على قيد الحياة ، تم تحضين خلايا BM MNCs أو خلايا CD34 البشرية ، بالإضافة إلى خطوط الخلايا المكونة للدم K-562 و HL-60 و Jurkat باستخدام SB 290157 (0-5 ميكروغرام / مل) لمدة 6 ساعة عند 37 درجة مئوية. تم بعد ذلك طلاء BM MNCs في مزارع ميثيل سلولوز خالية من المصل في وجود عامل تحفيز مستعمرة الخلايا الضامة المحببة (GM-CSF) + إنترلوكين 3 (IL-3) لوحدة تشكيل المستعمرات - مستعمرات البلاعم المحببة (CFU-GM) ، إرثروبويتين (EPO) + عامل الخلايا الجذعية (SCF) لمستعمرات وحدات الدم الحمراء (BFU-E) ، وثرومبوبويتين (TPO) لمستعمرات CFU-megakaryocytic (Meg) كما هو موصوف. 23 باستخدام مجهر مقلوب ، تم تسجيل مستعمرات المكونة للدم في الفئران في اليوم السابع والمستعمرات المكونة للدم البشرية في اليوم الثاني عشر. تم زراعة سلالات الخلايا لمدة 7 أيام متتالية. تم تحليل تكاثر خطوط الخلايا باستخدام مقايسة methyl thiazolyl tetrazolium (MTT) ، وتم إجراء تلطيخ Annexin V (أنظمة R & ampD ، Minneapolis ، MN) واستبعاد التريبان الأزرق كما هو موصوف. 26

بالنسبة لفحوصات CFU-الطحال (CFU-S) ، تم تشعيع فئران BALB / c الإناث (من 4 إلى 6 أسابيع) بجرعة قاتلة من تشعيع بيتا (900 cGy). بعد 24 ساعة ، خضعت الفئران لعملية زرع عن طريق الحقن في الوريد الذيل باستخدام 5 × 10 5 BM MNCs تم الحصول عليها من الفئران بالوزن المعالج أو غير المعالجة بـ SB 290157 (5 ميكروغرام / مل لكل 6 ساعات). في اليوم 12 ، تمت إزالة الطحال وتثبيته في مثبت Tellysyniczky ، وتم عد مستعمرات CFU-S على سطح الطحال باستخدام عدسة مكبرة كما هو موضح سابقًا. 9،22

فحص تدفق الكالسيوم

باختصار ، تم تحضين الخلايا لمدة 30 دقيقة عند 30 درجة مئوية مع 1-2 ميكرومتر Fura-2 / AM (مجسات جزيئية). بعد الحضانة ، تم غسل الخلايا مرة واحدة ، وتعليقها في المخزن المؤقت للتحميل بدون مصل العجل البقري (BCS) ، وتحفيزها باستخدام SDF-1β (500 نانوغرام / مل) في وجود أو عدم وجود 5 ميكروغرام / مل SB 290157 ، وتحليلها في غضون ساعة واحدة كما هو موضح سابقا. 9

فسفرة بروتينات المسار داخل الخلايا

تم إجراء تحليل البقعة الغربية على المستخلصات المحضرة من خلايا CD34 + التي تم حفظها في وسط RPMI الذي يحتوي على مستويات منخفضة من ألبومين مصل البقر (BSA ، 0.5٪) لجعل الخلايا هادئة. ثم تم تحفيز الخلايا باستخدام SDF-1 (300 نانوغرام / مل) أو C3a (1 ميكروغرام / مل) لمدة 10 دقائق عند 37 درجة مئوية في وجود أو عدم وجود SB 290157 (250 ميكرومتر) ، قبل أن يتم تحللها لمدة 10 دقائق في الجليد في محلول M-Per lysing (بيرس ، روكفورد ، إيل) يحتوي على مثبطات الأنزيم البروتيني والفوسفاتيز (سيغما كيميكال). تم فصل البروتينات المستخرجة على 10٪ جل رحلان كهربائي جل بولي أكريلاميد دوديسيل كبريتات الصوديوم (SDS-PAGE) وتم نقلها إلى غشاء النيتروسليلوز (اللمعان الكهربائي للكيمياء Hybond [ECL] Amersham Life Science ، Little Chalfont ، المملكة المتحدة). تم الكشف عن فسفرة AKT و 44/42 بروتين كيناز البروتين المنشط بالميتوجين (MAPK) عن طريق التكتل المناعي للبروتين باستخدام جسم مضاد MAPK أحادي النسيلة 44/42 خاص بالفوسفو ، والأجسام المضادة متعددة النسيلة الخاصة بفوسفو الأرانب (جميعها من نيو إنجلاند بيولابس ، بيفرلي ، ماساتشوستس) ) لكل من البروتينات المتبقية ، مع بيروكسيديز الفجل - الماعز المترافق المضاد للفأر IgG أو الماعز المضاد للأرنب IgG (سانتا كروز التكنولوجيا الحيوية ، سانتا كروز ، كاليفورنيا) كأجسام مضادة ثانوية ، كما هو موصوف. 26-29 تم تقييم التحميل المتكافئ في الممرات عن طريق تجريد البقع وإعادة تشكيلها بالأجسام المضادة أحادية النسيلة أو متعددة النسيلة المناسبة: p42 / 44 استنساخ الأجسام المضادة لـ MAPK 9102 واستنساخ الأجسام المضادة لـ AKT 9272 (نيو إنجلاند بيولابس). تم تطوير الأغشية باستخدام كاشف ECL (Amersham Life Science) ، وتجفيفها وتعريضها للفيلم (HyperFilm Amersham Life Science).

تعبئة الإشعاع الوهمي

تم تعريض الحيوانات العادية (بالوزن) أو C3aR (KO) للإشعاع المميت (850 cGy) وبعد 24 ساعة خضعت لعملية زرع من خلال الضفيرة المدارية الرجعية مع 5.5 × 10 6 BM MNCs من أي من الوزن أو حيوانات KO. تم السماح للحيوانات التي خضعت لعملية الزرع بالتعافي لمدة 5 أسابيع ، وبعد ذلك تم تعبئتها باستخدام G-CSF (250 ميكروغرام / كجم) لمدة 3 أيام متتالية. تم تقييم PB الخاصة بهم لعدد CFU-GMs / 100 ميكرولتر كما هو موصوف. 5 تم تأكيد تشابه الحيوانات التي خضعت لعملية زرع بواسطة تفاعل البوليميراز المتسلسل في الوقت الفعلي باستخدام نظام اكتشاف التسلسل ABI PRISM 7000 (النظم البيولوجية التطبيقية ، فوستر سيتي ، كاليفورنيا). تم عزل الحمض النووي من كل من PB و BM MNCs باستخدام مجموعة QIAamp DNA المصغرة (Qiagen ، فالنسيا ، كاليفورنيا). تم إجراء اكتشاف محدد للوزن أو الحمض النووي KO باستخدام بادئات خاصة بـ exon 2 في DNA بالوزن (A201-5′-GAG AAT CAG GTG AGC CAA GGA GAA-3 ′) أو للكاسيت الجديد (NeoA-5′-TGG GCT CTA TGG CTT CTG AGG CGG AAA G-3 ′) في KO DNA وبداية شائعة في المنطقة غير المشفرة (C1-5′-TAC AAT ATA GTC AGT TGG AAG TCA GCC-3 ′). تم حساب إجمالي الحمض النووي باستخدام جميع البادئات الثلاثة. تم تطبيع التفاعلات إلى إجمالي الحمض النووي وتم تحويل قيم ΔCT إلى تغييرات أضعاف باستخدام المعادلة 2 - CT. تم حساب فرق النسبة المئوية فيما يتعلق بالمقدار الإجمالي للحمض النووي.

تحليل احصائي

تم حساب الوسائل الحسابية والانحرافات المعيارية باستخدام برنامج Instat 1.14 (Graphpad، San Diego، CA). تم تعريف الدلالة الإحصائية على أنها ص أقل من .01. تم تحليل البيانات باستخدام الطالب ر اختبار العينات غير الزوجية.


مناقشة

جهاز المناعة الفطري مهيأ بشكل رائع لاكتشاف البكتيريا الموجودة على الأسطح المخاطية والاستجابة لها (38 ، 39). ومع ذلك ، فقد طورت مسببات الأمراض المخاطية المزمنة استراتيجيات متعددة لتخريب هذا الجانب من الاستجابة المناعية (40). جرثومة المعدة لقد تطور مع مضيفه البشري المشابه لأكثر من 100000 عام وهو متكيف بشكل فريد للبقاء على قيد الحياة لعقود من الزمن في البيئة القاسية للمعدة (41). وقد استلزم هذا تطوير آليات للحث على الالتهاب وكذلك استراتيجيات لتجنب الكشف وتقليل الاستجابة المناعية للمضيف.

جرثومة المعدة يحتوي على أنماط مخاطية متعددة مرتبطة بالعوامل الممرضة والتي تتفاعل بشكل مختلف مع المؤثرات المناعية الفطرية عن نظيراتها في مسببات الأمراض المخاطية الحادة الأخرى. على سبيل المثال، جرثومة المعدة FlaA هو جزيء غير التهابي من حيث قدرته على تنشيط TLR5 (42). جرثومة المعدة يحتوي LPS على دهون منشط للحساسية ، وهو قلب يحث على استجابة مخففة بوساطة TLR4 (43 ، 44). ال الخنجر يسلم T4SS الببتيدوغليكان إلى الخلايا المضيفة ، حيث يتم التعرف عليه بواسطة NOD1 (7-11) ، وعلى الرغم من أن تنشيط NF-B هو استجابة نموذجية لتنشيط NOD1 ، فقد أظهرنا نحن وآخرون أن التنشيط المسبق لـ NOD1 يقمع لاحقًا جرثومة المعدة- إشارات NF-B المستحثة عن طريق تنشيط حلقة التغذية الراجعة السلبية ، ويسمح نزع الأسيتيل للببتيدوغليكان جرثومة المعدة لتجنب تطهير المضيف (22 ، 45-47). أشارت الأعمال الحديثة أيضًا إلى أن NOD1 قد يثبط التهاب المعدة استجابةً لـ جرثومة المعدة. تران والزملاء. استخدم نموذج الفأر لالتهاب المعدة لإثبات ذلك جرثومة المعدة يعزز تنشيط IL33 ، وسيط الاستجابات المناعية Th2 ، عبر إشارات Nod1 (48). الأهم ، H. pylori cag + سلالات نشطة على وجه التحديد Nod1 في الخلايا الظهارية المعدية للفأر ، مما أدى إلى مستويات محسنة من IL33 في الغشاء المخاطي المعدي وخلايا الطحال ، والتي ارتبطت باستجابات IFNγ المنخفضة (48). تتوافق نتائجنا الحالية مع هذه البيانات ، مثل فقدان Nod1 في نموذجين مستقلين من جرثومة المعدة- تسبب الالتهاب والإصابة في زيادة الضرر داخل مكانة المعدة. ومع ذلك ، هناك مسارات إضافية يمكن أن تنظم التالية تنشيط NF-B جرثومة المعدة عدوى مستقلة عن NOD1. غال وزملاؤه. أظهر أن تنشيط NF-B يمكن تحفيزه عن طريق البروتين المتفاعل المرتبط بمستقبلات TNF (TRAF) مع المجال المرتبط بالشوكة (TIFA) ، وأن هذا يحدث بشكل مستقل عن تنشيط NOD1 بوساطة NF-B (49). علاوة على ذلك ، يتبع تنشيط NF-B جرثومة المعدة تحدث العدوى بطريقة منظمة مؤقتًا ، مع حدوث تحريض TIFA مبكرًا ، والذي يتبعه لاحقًا تنشيط NF-B المعتمد على NOD1 (49). قد يفسر التنشيط الانتقائي لهذه المسارات الإضافية في ظل ظروف تجريبية مختلفة الاختلافات في نتائجنا الحالية عند مقارنتها بالنتائج السابقة التي نشرتها Viala وزملاؤها (7). لذلك ، يجب أن تركز الدراسات المستقبلية على تقييم مسارات الإشارات المناعية الفطرية NOD1 و TIFA في أنظمة العضويات الأولية وكذلك النماذج الحيوانية للعدوى ، باستخدام كل من WT. H. pylori cag + سلالات وسلالات متحولة معيبة الخنجر أنظمة الإفراز ، لتوضيح المساهمات الاندماجية لهذه المكونات بدقة جرثومة المعدة طريقة تطور المرض.

في هذه الدراسة، Nod1 - / - لم تغير الأنماط الجينية من النمط الظاهري الميكروبي لـ جرثومة المعدة مشتقات الإخراج من حيث دالة T4SS. لكن، Nod1أصيبت الفئران التي تعاني من نقص في التهابات أكثر شدة مقارنة بالفئران WT عند استعمارها جرثومة المعدة سلالات تأوي وظيفية الخنجر T4SS. باستخدام مجموعة السيتوكينات المتعددة لفحص المؤثرات المناعية المتميزة للمضيف والتي قد تساهم في هذه الزيادة في الالتهاب ، لاحظنا ، كما هو متوقع ، جرثومة المعدة زادت العدوى على نطاق واسع من مستويات السيتوكينات Th1 و Th2 و Th17 ، وزادت هذه التغييرات في وجود نقص Nod1. ومع ذلك ، تضاءلت الاختلافات الطبقية على أساس النمط الجيني Nod1 بمرور الوقت. لتشريح هذا بشكل أكبر ، استخدمنا نظامًا اختزاليًا مبتكرًا تكون فيه تأثيرات جرثومة المعدة على WT أو Nod1 - / - الخلايا الظهارية وحدها أو الخلايا الظهارية المزروعة بضامة متفاوتة Nod1 يمكن التأكد من النمط الجيني. لقد قررنا أن فقدان Nod1 في كل من الخلايا الظهارية والضامة أدى إلى زيادة إنتاج السيتوكينات المنشطة للالتهابات استجابةً لـ جرثومة المعدة العدوى ، مما يدعم فرضية أن NOD1 يغير بشكل أساسي الاستجابات المناعية الفطرية لهذا العامل الممرض.لتحديد المساهمات الخاصة بكل من هذه المكونات الخلوية بشكل كامل ، سيتطلب القضاء على البلاعم ومكون الخلية الظهارية المعدية للإشارات المعتمدة على Nod1 ، بشكل فردي وجماعي. يمكن القيام بذلك عن طريق العبور Nod1-floxed الفئران و Foxa3-Cre الفئران (التي توجه التعبير عن كري recombinase إلى ظهارة المعدة المرجع. 50) بالتزامن مع الاستنفاد الانتقائي للبلاعم باستخدام عوامل مثل الليبوزومات الكلودرونات وقد وفرت نتائجنا الحالية إطارًا مهمًا لهذه الدراسات المستقبلية.

بالإضافة إلى الاختلافات في مستويات السيتوكين بين Nod1 + / + و Nod1 - / - الفئران ، وجدنا أيضًا اختلافات في مستويات بعض السيتوكينات عندما قارنا C57BL / 6 مع الفئران INS-GAS FVB / N. من المحتمل أن تعكس هذه النتائج الاختلافات في الخلفيات الجينية للفئران قيد الدراسة بالإضافة إلى وجود فرط جسترين الدم ، وهو متأصل في فئران INS-GAS التي تحمل جين الجاسترين البشري المتحور (51). يمارس الجاسترين تأثيرات شبيهة بعامل النمو على الخلايا الظهارية في المعدة ، والتي قد تحفز إنتاج بعض الكيميائيات والسيتوكينات (51). علاوة على ذلك ، فإن فئران INS-GAS على خلفية وراثية FVB / N والتي سبق أن ثبت أنها تزيد من خطر التسرطن بالمقارنة مع الفئران C57BL / 6. على وجه التحديد ، قد يكون هذا بسبب تعدد الأشكال داخل Ptch1 الجين ، الذي يشفر مستقبلات مثبطة للرابطات من عائلة جين القنفذ (52). في سياق نتائجنا ، كان من الملاحظ ، من بين أمور أخرى ، أن مستويات التعبير عن IL9 قد تم تنظيمها في INS-GAS Nod1 - / - الفئران عند مقارنتها بـ C57BL / 6 Nod1 - / - الفئران. IL9 هو سيتوكين تنتجه خلايا Th9 ، وهي مجموعة سكانية فرعية من خلايا CD4 + T ، وقد أظهرت العديد من الدراسات أن IL9 يثبط نمو الورم (53 ، 54). وهكذا ، انخفضت مستويات IL9 في جرثومة المعدة- INS-GAS المصابة Nod1 - / - قد تساهم الفئران في النمط الظاهري المُسرطن المُحسَّن في هذه الفئران بعد الإصابة بهذا المُمْرِض.

يمكن للتغييرات في تكوين الأنماط الظاهرية للبلاعم الوظيفية داخل مكانة ملتهبة محددة أن تغير بشكل كبير من خطر التسرطن (55). تقوم الضامة M1 (المنشط كلاسيكيا) بإزالة مسببات الأمراض من خلال نشاط مبيد الميكروبات داخل الخلايا وعن طريق إفراز وسطاء التهابات يعززون استجابة من النوع Th1 ، بينما يثبط في نفس الوقت استجابات من النوع Th2 (55). تعمل البلاعم M2 (التي يتم تنشيطها بدلاً من ذلك) على تعزيز التئام الجروح عن طريق إفراز مكونات المصفوفة خارج الخلية والمؤثرات المضادة للالتهابات التي تعزز الاستجابات الموجهة من Th2 بينما تخمد استجابات Th1 (5). Mregs (الضامة التنظيمية) هي أيضًا مضادة للالتهابات ، لكنها تفشل في إيداع مصفوفة خارج الخلية (55). النتائج التي توصلنا إليها باستخدام الجهاز الهضمي الظهاري: زراعة البلاعم مع أو بدون جرثومة المعدة كشف أن NOD1 يلعب على الأرجح دورًا في استقطاب البلاعم حيث طورت البلاعم Nod1 WT المزروعة بخلايا ظهارية نمطًا ظاهريًا عميقًا M1 بعد التعرض لـ جرثومة المعدة مقارنة مع النمط الظاهري M1 / ​​M2 المختلط الذي أظهرته المصابة Nod1 - / - البلاعم. قد يجعل مثل هذا النمط الظاهري الهجين البلاعم التي تعاني من نقص Nod1 غير فعالة في تثبيط الاستجابات الموجهة من Th1- أو Th2 ، مما يؤدي إلى نمط أكثر حدة من الالتهاب العالمي ، توفر نتائجنا الحالية إطارًا مهمًا لتحديد مثل هذه الآليات في العمل المستقبلي. وبالتالي ، فإن قدرة NOD1 على تنظيم الأنماط الظاهرية للبلاعم قد تساهم أيضًا في قدرة جرثومة المعدة للتهرب من التطهير المناعي للمضيف.

في الختام ، توضح هذه الدراسة أن فقدان NOD1 يزيد من الاستجابات الالتهابية لـ جرثومة المعدة في سياق تسرطن المعدة. قد يمارس NOD1 دوره المقيد عن طريق تغيير استقطاب البلاعم ، مما يؤدي إلى التهرب المناعي والثبات الميكروبي. تضع هذه الدراسات الأساس لمزيد من الاستكشاف في دور NOD1-جرثومة المعدة التفاعلات في المضيفين من البشر وتشير إلى أن التلاعب بـ NOD1 قد يمثل استراتيجية جديدة لمنع أو علاج النتائج المرضية التي يسببها جرثومة المعدة عدوى.


توافر البيانات والمواد

تم الحصول على متواليات Hi-C المنشورة لـ ESCs و NPCs من مجموعة بيانات NCBI GEO GSE96107 [63]. تتوفر متواليات ChIP-seq و RNA-seq و 4C-seq التي لم يتم معالجتها والتي تم إنشاؤها في هذه الدراسة من مستودع أرشيف النيوكليوتيدات الأوروبي (EMBL-EBI ENA) تحت رقم الانضمام PRJEB28762 [64]. تتوفر أنماط تفاعل 4C-seq المعالجة من مستودع بيانات Mendeley [65]. تتوفر بيانات الفحص المجهري الخام من مستودع Figshare [66].


مقدمة

يعد الأدينوزين مستقلبًا مهمًا مثبطًا للمناعة ، وهو ضروري للحماية من رد الفعل المناعي المفرط أثناء الالتهاب وتلف الأنسجة (1). استجابة لنقص الأكسجة والإجهاد خارج الخلية ، يتم إنشاء الأدينوزين من ATP بواسطة ectonucleotidase CD39 و CD73 والإشارات عبر أربعة مستقبلات أدينوزين مقترنة ببروتين G (A1 ، A2A ، A2B ، A3 راجعها المرجع 2). يتم التعبير عن مستقبل الأدينوزين A2A عالي التقارب (A2AR) بشكل كبير في الخلايا الليمفاوية وقد ثبت أنه يبطل نشاطها. في البيئة الدقيقة للورم (TME) ، تمنع إشارات الأدينوزين عبر A2AR الاستجابة المناعية الفعالة المضادة للورم عن طريق تثبيط تسلل ووظيفة الخلايا CD8 + T والخلايا القاتلة الطبيعية (NK) (3-6). بالإضافة إلى ذلك ، فقد ثبت أن إشارات A2AR تمنع تنشيط البلاعم (7) وتؤثر على تكاثر الخلايا اللمفاوية التائية ، والتهيئة ، وإنتاج السيتوكينات ، مما يؤدي إلى الاستقطاب لصالح الخلايا التنظيمية التائية المثبطة للمناعة (8-10). في حالة الاستتباب ، تعرض الفئران التي تعاني من نقص A2AR انخفاضًا في خلايا CD44 lo CD4 + و CD8 + T الساذجة ، مما يشير إلى أن إشارات الأدينوزين أمر بالغ الأهمية لصيانة الخلايا التائية (11). ومع ذلك ، فإن فهم تأثير إشارات A2AR على الخلايا القاتلة الطبيعية يظل محدودًا لتقليل السمية الخلوية وإنتاج السيتوكين استجابةً للأدينوزين الخارجي ومضاهاته الأدينوزين في المختبر (4, 12, 13).

تشتمل المجموعة الأولى من الخلايا اللمفاوية الفطرية على كل من الخلايا القاتلة الطبيعية والخلايا اللمفاوية الفطرية من النوع الأول (ILC1) ، ويبدو أن الأخير يقتصر على الإقامة في الأنسجة (14). الخلايا القاتلة الطبيعية هي خلايا ليمفاوية مستجيبة فطرية حاسمة في التعرف السريع على الخلايا الشاذة المتحولة أو المصابة. تعتمد وظيفتها على مشاركة مستقبلات التنشيط أو المثبطة الموجودة على سطح الخلية ، والتي تملي إطلاق الحبيبات السامة للخلايا والسيتوكينات المؤيدة للالتهابات (14 ، 15). تتميز المجموعات الفرعية المتميزة وظيفيًا لنضج الخلايا القاتلة الطبيعية بالتعبير عن CD11b / CD27 / KLRG1 و DNAM-1 في الفئران (16-18) و CD56 / CD16 في البشر (19). يمنع النقص في عدد من المسارات بما في ذلك إشارات IL15 وعوامل النسخ EOMES و GATA-3 و AIOLOS و ZEB2 و T-BET نمو الخلايا القاتلة الطبيعية الناضجة (20-24). ومع ذلك ، لا تزال المسارات التنظيمية التي تدفع نضوج الخلايا القاتلة الطبيعية غير محددة بشكل جيد. في الآونة الأخيرة ، تم تحديد تراكم الخلايا القاتلة الطبيعية الناضجة وظيفيًا في الفئران التي تحتوي على خلايا NK التي تعاني من نقص FOXO1 (25). نظرًا لقدرتها على توليد استجابة مناعية سريعة المفعول ومستقلة عن المستضد ، يتم النظر بشكل متزايد في الخلايا القاتلة الطبيعية لإمكانياتها العلاجية. يعد تحديد المسارات التي تعزز تراكم الخلايا القاتلة الطبيعية الناضجة وظيفيًا ذا أهمية كبيرة.

هنا ، نظهر أن النقص في إشارات A2AR يعزز نضوج الخلايا القاتلة الطبيعية في التوازن ، حيث تعرض خلايا NK الناضجة بشكل نهائي وظيفة متزايدة ومناعة ضد الأورام. حاليًا ، تخضع مضادات A2AR لتجارب سريرية من أجل سلامتها وفعاليتها في الأورام الصلبة إما بمفردها أو بالاشتراك مع العلاجات المناعية الأخرى (NCT02655822 و NCT02403193). بناءً على النتائج التي توصلنا إليها ، ينبغي النظر في استخدام مضادات A2AR كعلاج مساعد لتحفيز فعالية العلاج المناعي القائم على الخلايا القاتلة الطبيعية.


أساليب

تحليل التعبير مرنا

تم شراء مجموعة الأنسجة البشرية المتعددة (MTE ™) من مختبرات Clonetech (Cat. # 775-1). يحتوي على mRNA بكميات طبيعية للتعبير عن ثمانية جينات مختلفة للتدبير المنزلي. احتوى مسبار (كدنا) المسمى المشع P32 المستخدم في التهجين على تسلسل متباين سعة 4 كيلو بايت يشفر مجال بليكسين خارج الخلية تم الحصول عليه عن طريق تقييد EcoRI لبناء كامل الطول البشري. تم إجراء التهجين باستخدام محلول Ultrahybe ® (Ambion Austin ، TX ، الولايات المتحدة) وفقًا للبروتوكول المقدم من الشركة المصنعة.

تم الكشف عن تعبير Plexin في الخلايا البطانية للوريد البشري (Cambrex) بواسطة RT-PCR باستخدام أزواج التمهيدي الخاصة بالجينات المقدمة بواسطة Applied Biosystem (Hs00182227_m1 لـ PlexinB1 و Hs00367063_m1 لـ PlexinB2).


تمنع الخلايا التائية الذاتية الهروب المناعي للورم بعد العلاج بالخلايا التائية بالتبني

مركز أبحاث ماكماستر للمناعة ، قسم علم الأمراض والطب الجزيئي ، جامعة ماك ماستر ، هاميلتون ، أونتاريو ، كندا.

مراسلات العنوان إلى: Yonghong Wan، Department of Pathology and Molecular Medicine، McMaster University، Room MDCL-5024، 1200 Main Street West، Hamilton، Ontario، Canada، L8N 3Z5. الهاتف: 905.525.9140 ext. 22461 بريد إلكتروني: [email protected]

مركز أبحاث ماك ماستر للمناعة ، قسم علم الأمراض والطب الجزيئي ، جامعة ماك ماستر ، هاميلتون ، أونتاريو ، كندا.

مراسلات العنوان إلى: Yonghong Wan، Department of Pathology and Molecular Medicine، McMaster University، Room MDCL-5024، 1200 Main Street West، Hamilton، Ontario، Canada، L8N 3Z5. الهاتف: 905.525.9140 ext. 22461 بريد إلكتروني: [email protected]

اعثر على مقالات بواسطة Simovic، B. في: JCI | PubMed | منحة جوجل

مركز أبحاث ماك ماستر للمناعة ، قسم علم الأمراض والطب الجزيئي ، جامعة ماك ماستر ، هاميلتون ، أونتاريو ، كندا.

مراسلات العنوان إلى: Yonghong Wan، Department of Pathology and Molecular Medicine، McMaster University، Room MDCL-5024، 1200 Main Street West، Hamilton، Ontario، Canada، L8N 3Z5. الهاتف: 905.525.9140 ext. 22461 بريد إلكتروني: [email protected]

مركز أبحاث ماكماستر للمناعة ، قسم علم الأمراض والطب الجزيئي ، جامعة ماك ماستر ، هاميلتون ، أونتاريو ، كندا.

مراسلات العنوان إلى: Yonghong Wan، Department of Pathology and Molecular Medicine، McMaster University، Room MDCL-5024، 1200 Main Street West، Hamilton، Ontario، Canada، L8N 3Z5. الهاتف: 905.525.9140 ext. 22461 بريد إلكتروني: [email protected]

مركز أبحاث ماك ماستر للمناعة ، قسم علم الأمراض والطب الجزيئي ، جامعة ماك ماستر ، هاميلتون ، أونتاريو ، كندا.

مراسلات العنوان إلى: Yonghong Wan، Department of Pathology and Molecular Medicine، McMaster University، Room MDCL-5024، 1200 Main Street West، Hamilton، Ontario، Canada، L8N 3Z5. الهاتف: 905.525.9140 ext. 22461 بريد إلكتروني: [email protected]

مركز أبحاث ماك ماستر للمناعة ، قسم علم الأمراض والطب الجزيئي ، جامعة ماك ماستر ، هاميلتون ، أونتاريو ، كندا.

مراسلات العنوان إلى: Yonghong Wan، Department of Pathology and Molecular Medicine، McMaster University، Room MDCL-5024، 1200 Main Street West، Hamilton، Ontario، Canada، L8N 3Z5. الهاتف: 905.525.9140 ext. 22461 بريد إلكتروني: [email protected]

اعثر على مقالات بواسطة ك. ستيفنسون في: JCI | PubMed | منحة جوجل

مركز أبحاث ماك ماستر للمناعة ، قسم علم الأمراض والطب الجزيئي ، جامعة ماك ماستر ، هاميلتون ، أونتاريو ، كندا.

مراسلات العنوان إلى: Yonghong Wan، Department of Pathology and Molecular Medicine، McMaster University، Room MDCL-5024، 1200 Main Street West، Hamilton، Ontario، Canada، L8N 3Z5. الهاتف: 905.525.9140 ext. 22461 بريد إلكتروني: [email protected]

مركز أبحاث ماك ماستر للمناعة ، قسم علم الأمراض والطب الجزيئي ، جامعة ماك ماستر ، هاميلتون ، أونتاريو ، كندا.

مراسلات العنوان إلى: Yonghong Wan، Department of Pathology and Molecular Medicine، McMaster University، Room MDCL-5024، 1200 Main Street West، Hamilton، Ontario، Canada، L8N 3Z5. الهاتف: 905.525.9140 ext. 22461 بريد إلكتروني: [email protected]

اعثر على مقالات بواسطة Bramson، J. في: JCI | PubMed | منحة جوجل

مركز أبحاث ماكماستر للمناعة ، قسم علم الأمراض والطب الجزيئي ، جامعة ماك ماستر ، هاميلتون ، أونتاريو ، كندا.

مراسلات العنوان إلى: Yonghong Wan، Department of Pathology and Molecular Medicine، McMaster University، Room MDCL-5024، 1200 Main Street West، Hamilton، Ontario، Canada، L8N 3Z5. الهاتف: 905.525.9140 ext. 22461 بريد إلكتروني: [email protected]

مركز أبحاث ماكماستر للمناعة ، قسم علم الأمراض والطب الجزيئي ، جامعة ماك ماستر ، هاميلتون ، أونتاريو ، كندا.

مراسلات العنوان إلى: Yonghong Wan، Department of Pathology and Molecular Medicine، McMaster University، Room MDCL-5024، 1200 Main Street West، Hamilton، Ontario، Canada، L8N 3Z5. الهاتف: 905.525.9140 ext. 22461 بريد إلكتروني: [email protected]

تم النشر في 4 تشرين الثاني (نوفمبر) 2019 - مزيد من المعلومات

في حين أن نتيجة العلاج بالخلايا التائية بالتبني (ACT) ترتبط عادةً بوظيفة الخلايا التائية الملقحة ، فإن دور الخلايا التائية الذاتية غير معروف. لقد أظهر نجاح علاج حاجز نقاط التفتيش القيمة العلاجية المحتملة للخلايا التائية الموجودة مسبقًا في علاج السرطان. بالنظر إلى النتائج المستخلصة من علاج الحصار في نقاط التفتيش ، افترضنا أن الخلايا التائية الذاتية تساهم في البقاء على قيد الحياة على المدى الطويل بعد ACT. هنا ، نصف نهجًا علاجيًا يجمع بين ACT مع لقاح حال للأورام يسمح بالتحليل المتزامن للمناعة المضادة للورم بوساطة الخلايا التائية المنقولة والداخلية. وجدنا أنه بالإضافة إلى تعزيز التوسع وتسلل الورم للخلايا التائية المنقولة ، فإن اللقاحات الحالة للأورام عززت الخلايا التائية المضيفة للورم. لقد قررنا أن الخلايا التائية المنقولة ساهمت في التدمير السريع لكتل ​​الورم الكبيرة بينما حالت الخلايا التائية الذاتية في نفس الوقت دون ظهور متغيرات فقدان المستضد. علاوة على ذلك ، بينما اختفت الخلايا التائية المنقولة بعد فترة وجيزة من ارتداد الورم ، أمنت الخلايا التائية الذاتية الذاكرة طويلة المدى مع ذخيرة واسعة من خصوصية المستضد. تشير النتائج التي توصلنا إليها إلى أن استراتيجية التوليف هذه قد تستغل الإمكانات الكاملة للخلايا التائية المضيفة التي تستعد للورم والقضاء على الورم الأساسي ، ومنع الهروب المناعي ، وتوفير ذاكرة واقية طويلة المدى.

تشير الأدلة المترابطة المتراكمة إلى أنه يمكن تنشيط الخلايا التائية المضيفة تلقائيًا استجابة للورم المتنامي من خلال التعرف على مستضدات الورم. على وجه الخصوص ، من المرجح أن تقوم الأورام التي تحتوي على أعداد كبيرة من الطفرات بتنشيط الخلايا التائية الذاتية بسبب مناعة المستضدات الجديدة التي يتعرف عليها الجهاز المناعي على أنها غريبة ، وبالتالي توفر أهدافًا لهجوم الخلايا التائية (1). تم التأكيد على الأهمية السريرية لهذه النتائج من خلال الارتباط بين حمل الطفرة ونتائج العلاج باستخدام حاجز نقطة التفتيش المناعي الذي يعتمد على وجود مجموعات الخلايا التائية الورمية (2-5). ومع ذلك ، فإن استجابات الخلايا التائية العفوية ضد المستضدات الطافرة غير فعالة نسبيًا وتفشل في التوسط في رفض الورم في معظم الحالات. في الواقع ، تشير حقيقة أن مجموعة فرعية فقط من المرضى تظهر استجابات دائمة لحصار نقاط التفتيش المناعي إلى أنه ليس كل المرضى لديهم خلايا تائية معدة للورم كافية للقضاء على الأورام بمجرد إطلاق العنان لها.

يمثل العلاج بالخلايا التائية (ACT) مع الخلايا التائية الخاصة بالمستضد بديلاً ممتازًا لعلاجات مثبطات نقاط التفتيش لعلاج الأورام الخبيثة (6). يمكن زراعة الخلايا التائية السليمة الخاصة بالورم في المختبر وغرسها بأعداد كبيرة في المرضى المصابين بمرض متقدم ، وبالتالي التغلب على قصور الاستجابات التلقائية للخلايا التائية في مرضى السرطان. الأهم من ذلك ، تم تطوير المنهجيات السريرية لنشر الخلايا التائية الوظيفية الخاصة بالورم في المختبر (7-9) ، وقد أثبتت النجاحات السريرية الحديثة في سرطان الدم ، والورم الميلانيني ، والورم الأرومي العصبي ، والأورام الخبيثة المرتبطة بـ EBV أن ACT هو استراتيجية فعالة وفعالة في البشر (10 - 14). ومع ذلك ، فإن الخطوة المطلوبة لنجاح العلاج التوليفي القائم على التوليف هي استنفاد اللمفاوية للمضيف قبل حقن الخلايا التائية ، وهي عملية تسمى التكييف المسبق ، وهي شديدة السمية لبعض المرضى (15 - 17). علاوة على ذلك ، على الرغم من أن الشروط المسبقة قد تخلق بيئة مواتية للخلايا التائية المنقولة بالتبني (أي القضاء على الخلايا التائية التنظيمية و "أحواض" السيتوكين المتجانسة) ، فإنها تزيل أيضًا الخلايا التائية الموجودة مسبقًا ، مما يجعل من الصعب ، إن لم يكن من المستحيل ، تحديد دور وفائدة المناعة الذاتية المضادة للورم في سياق ACT.

لقد أبلغنا سابقًا أن فيروسات الأورام (OVs) المصممة للتعبير عن المستضدات المرتبطة بالورم يمكنها المشاركة بشكل فعال وتوسيع خلايا الذاكرة التائية الخاصة بالورم مع الاحتفاظ بقدرتها الكامنة على إصابة الورم وإزالته بشكل مباشر وعكس البيئة المكروية للورم المثبط للمناعة (18 ، 19) ). في هذه الدراسة ، بحثنا في استخدام لقاح الورم القائم على فيروس الربد وفيروس اللقاح (VacV-based) لدفع التوسع الجهازي وتسلل الورم للخلايا التائية المنقولة بالتبني ، وبالتالي تعزيز الفعالية العلاجية لـ ACT. أدى هذا المزيج العقلاني إلى تراجع الورم بشكل كامل ودائم في حالة عدم وجود شروط مسبقة ، وهي نتيجة محتملة للسيتوكينات المسببة للالتهابات التي يسببها الفيروس والتي توفر الدعم لاستجابات الخلايا التائية المضادة للورم (20). باستخدام هذا النموذج ، قمنا في نفس الوقت بمراقبة مساهمة الخلايا التائية المنقولة والداخلية في التأثير العلاجي. تشير بياناتنا إلى أن الخلايا التائية المضيفة الموجودة مسبقًا والمجهزة للورم ضرورية لمنع و / أو القضاء على متغيرات هروب المستضد لتحقيق تراجع دائم عن طريق ACT وللذاكرة المناعية طويلة المدى.

يؤدي الجمع بين ACT مع لقاحات حال الورم إلى تحفيز الارتداد الكامل للورم والمناعة الوقائية طويلة الأمد. بدافع من القدرة الفريدة للقاحات Rhabdoviral OV (OVVs) على إحداث توسع فعال لخلايا الذاكرة المركزية الموجودة مسبقًا (Tcm) في المحيط والتجنيد السريع في الورم (18 ، 19 ، 21) ، استكشفنا مزيجًا من ACT باستخدام Tcm في مستضد الورم المتمايز المختبر مع لقاحات فيروس التهاب الفم الحويصلي (VSV) لعلاج الأورام الصلبة الثابتة. تم تحدي الفئران WT BALB / c داخل الأدمة (معرف) بخلايا CMS5 ، وهي ساركومة ليفية مستحثة بالميثيلكولانثرين تعبر عن موضع جديد محدد مشتق من طفرة في جين ERK2 (ErkM).136–144، QYIHSANVL) (22). ErkM136–144- تم زراعة خلايا CD8 + T محددة من الفئران المعدلة وراثيًا DUC18 (23) وتوسيعها في وجود IL-15 و IL-21 و rapamycin ، مما أدى إلى اكتساب النمط الظاهري Tcm النموذجي (CD62L + CD44 +) (الشكل التكميلي 1A المواد التكميلية متاحة على الإنترنت مع هذه المقالة https://doi.org/10.1172/JCI126199DS1). بعد 6 أيام من نمو الورم ، عولجت الفئران بالحقن الوريدي. حقن 10 6 DUC18 Tcm ، 10 8 PFU من VSV-ErkM ، أو مزيج من DUC18 Tcm متبوعًا بعد 24 ساعة بواسطة VSV-ErkM. اخترنا اختبار i.v. إعطاء VSV حصريًا ، كما أوضحنا سابقًا أن هذا هو الطريق الأمثل لتحقيق كل من عرض المستضد في المحيط لتعزيز Tcm وعدوى الورم لتحلل الأورام وتجنيد الخلايا التائية بواسطة لقاح VSV (18 ، 19).في الواقع ، فشل الحقن داخل الورم لـ VSV في تعزيز الخلايا التائية المنقولة باستمرار إلى مستوى فعال والتسبب في تراجع الورم (البيانات غير معروضة). يوضح الشكل 1 أ أنه لم يكن لقاح Tcm وحده ولا لقاح VSV وحده تأثيرًا كبيرًا على نمو الورم ، في حين أن الجمع بين لقاح Tcm و VSV الذي يعزز الانحدار الكامل للورم والبقاء لفترات طويلة بشكل ملحوظ (الشكل 1B). ومع ذلك ، فشلت خلايا المستجيب DUC18 T (Teff) (المتباينة في وجود الشكل التكميلي 1A IL-2) ، إما بمفردها أو بالاشتراك مع VSV-ErkM ، في إحداث انحدار كامل ومستدام للورم في جميع الفئران المعالجة (الشكل 1C) ، وهي نتيجة ارتبطت بضعف ثبات الخلايا المنقولة (البيانات غير معروضة). على الرغم من أن التطعيم ضد VSV كان قادرًا على إطالة فترة البقاء على قيد الحياة بشكل ملحوظ بعد نقل Teff ، إلا أن الانحدار الناجم عن Tcm بالإضافة إلى VSV-ErkM كان أكثر اتساقًا ، وتم إطالة فترة البقاء اللاحقة بشكل كبير على العلاجات المستندة إلى Teff (الشكل 1 د) ، بما يتوافق مع عملنا السابق وفهمنا الحالي ( 19 ، 24).

يؤدي الجمع بين Tcm و VSV-ErkM إلى تراجع الورم بشكل دائم. تم تلقيح الفئران BALB / ج معرف. باستخدام خلايا CMS5 قبل 7 أيام من النقل بالتبني لـ DUC18 Tcm (10 6 خلايا / فأر) ، وعند الحاجة ، تم علاجها باللقاح / الفيروس المحدد بعد 24 ساعة. تم تضمين الفئران التي تتلقى VSV-ErkM بمفردها أو Tcm بمفردها أو PBS كعناصر تحكم. (أ, ج، و ه) أحجام الورم و (ب, د، و F) تم رصد بقاء الفئران CMS5 TB BALB / c عند dpt المحدد مع 0 dpt تمثل يوم تلقيح اللقاح وتم التعبير عنها بـ mm 3. تم استخدام حجم الورم 1000 مم 3 كنقطة نهاية لتحليل البقاء على قيد الحياة. (جي) الفئران التي نجت من تحدي الورم الأولي CMS5 بعد العلاج باستخدام Tcm بالإضافة إلى VSV-ErkM تمت إعادة تحديها بخلايا CMS5 بعد 60 يومًا ، ويظهر البقاء على قيد الحياة لاحقًا. تم تضمين مجموعة من الفئران الساذجة مع خلايا CMS5 كعنصر تحكم. يتم عرض البيانات كنتائج تمثيلية من 4 (أ و ب), 3 (جF) أو 2 (F) تجارب مستقلة مع ن = 5 لكل مجموعة. تم تحليل البيانات باستخدام اختبار رتبة السجل (Mantel-Cox) (ب, د, F و جي). *ص & lt 0.05 **ص & لتر 0.01.

لتحديد ما إذا كان Tcm زائد OV (بدون مستضد الورم المحدد) وحده أو اللقاح التقليدي (بدون نشاط تحلل الورم أو استهداف الورم) وحده كافٍ لتحقيق فعالية مماثلة لتلك الخاصة بلقاح Tcm plus oncolytic ، قمنا باختبار مجموعات إضافية ، بما في ذلك VSV- MT (تفتقر إلى التحوير ErkM) ، ناقل غدي ناقص النسخ المتماثل يعبر عن ErkM (Ad-ErkM) ، والببتيد ErkM المساعد مع الأجسام المضادة poly I: C / CD40 (25). كما هو مبين في الشكل 1 ، فشل E و F و Tcm بالإضافة إلى VSV-MT في التحكم في نمو الورم أو إطالة البقاء على قيد الحياة ، مما يؤكد أن التطعيم OV الخاص بمستضد معين مطلوب لتوسيع الخلايا التائية المنقولة وتجنيدها في الورم. تمشيا مع هذه الفكرة ، كان التعزيز باستخدام اللقاحات غير الحالة أقل فاعلية من لقاح VSV ، حيث أظهر جزء صغير فقط من الفئران المعالجة انحدارًا كاملاً للورم وبقاء طويل الأمد (الشكل 1 و E و F).

لتصور تسلل الورم لخلايا CD8 + T مباشرة وتوطينها في الورم ، قمنا بتلوين أنسجة الورم في اليوم الخامس بعد تلقيح ACT أو ACT plus. كما هو مبين في الشكل 2 ، كان التوزيع حول الرحم لخلايا CD8 + T واضحًا بعد نقل Tcm بمفرده وتلقيح Tcm بالإضافة إلى اللقاح ، ولكن لوحظ وجود عدد أكبر بكثير من خلايا CD8 + T (الشكل التكميلي 2) التي توغلت بعمق في أنسجة الورم بعد VSV تعزيز ، والتأكيد على أن OVVs تقدم مزايا مميزة على اللقاحات التقليدية في سياق ACT. أخيرًا ، رفض 100 ٪ من الناجين على المدى الطويل (60+ يومًا) بعد علاج Tcm بالإضافة إلى VSV-ErkM إعادة التحدي مع خلايا CMS5 بعد شهرين من توقف العلاج وأظهروا بقاءًا طويلًا بشكل ملحوظ ، مما يشير إلى تكوين ذاكرة مناعية فعالة (الشكل 1G).

يحفز علاج OVV تسلل الورم إلى خلايا CD8 + T. تُظهر الصور المجهرية لأنسجة الورم CMS5 الملطخة بجسم مضاد لـ CD8 تسللًا نسبيًا لنواة الورم ومحيطه بالخلايا التائية الناتجة عن العلاجات الموضحة. يتم عرض الصور ذات التكبير المنخفض للورم بأكمله في اللوحات اليسرى ، وتظهر الصور المكبرة الأعلى لمحيط الورم (الموضحة بالمربعات السوداء) ولب الورم (الموضحة بالمربعات الزرقاء) في اللوحين الأوسط والأيمن. أشرطة النطاق: 500 ميكرومتر (اللوحات اليسرى) 200 ميكرومتر (الألواح الوسطى واليمنى).

يتم تحديد تمدد واستمرار خلايا CD8 + T الذاتية المتفاعلة من ErkM بواسطة الورم أثناء العلاج المركب. لفهم كيفية تأثير لقاح VSV على مصير الخلايا التائية المنقولة ، قمنا أيضًا بمراقبة استجابات الخلايا التائية في المحيط. ErkM136–144- يمكن الكشف عن توسع خلايا CD8 + T الخاصة في الدورة الدموية في وقت مبكر بعد يومين من التطعيم ضد VSV ، والذي بلغ ذروته في اليوم الخامس وانخفض بعد ذلك (الشكل 3 أ) ، بالتزامن مع حركية انحدار الورم CMS5 (الشكل التكميلي 1 ب). على الرغم من انخفاض استجابات الخلايا التائية الخاصة بالمستضد بعد الذروة ، إلا أنها ظلت عند حوالي 10 ٪ من خلايا CD8 + T المتداولة لأكثر من شهرين (الشكل 3 أ). ومن المثير للاهتمام ، أن التحليل الإضافي باستخدام العلامات الجينية أشار إلى أن توسع ErkM136–144- سيطرت خلايا T الخاصة بخلايا DUC18 المنقولة بالتبني (Thy1.1 +) في 5 أيام بعد العلاج (dpt) ، ولكن تم استبدالها بخلايا CD8 + T داخلية (Thy1.2 +) من 12 dpt فصاعدًا (الشكل 3B). لتحديد ما إذا كان فقدان خلايا DUC18 المنقولة من الدورة الدموية ناتجًا عن التوطين التفاضلي ، قمنا بتحليل الدم والطحال ونخاع العظام في اليوم 60 بعد العلاج. غالبية ErkM136–144- كانت الخلايا التائية الخاصة عبارة عن خلايا CD8 + T داخلية المنشأ في جميع الأجزاء الثلاثة ، مما يؤكد أن خلايا DUC18 المنقولة اختفت بالفعل بعد انحدار الورم (الشكل 3 ج). دفعتنا هذه الملاحظة إلى تقييم ErkM136–144- استجابات الخلايا التائية المحددة التي تحركها VSV-ErkM في الحيوانات الساذجة الخالية من الورم (TF) مقارنة بالفئران الحاملة للورم (TB). تلقت الفئران WT BALB / c 10 6 DUC18 Tcm قبل يوم واحد من التطعيم مع 10 8 PFU من VSV-ErkM ، وتم رصد استجابات الخلايا التائية الخاصة بـ ErkM في الأيام 5 و 12 و 19 بعد علاج VSV. يوضح الشكل ثلاثي الأبعاد أن حركية تمدد الخلايا التائية في فئران TF كانت مماثلة لتلك الموجودة في حيوانات السل ، على الرغم من أن معدل الانكماش كان أبطأ بشكل ملحوظ عند 12 ديسبلت. الأهم من ذلك ، وجود نسبة مئوية أعلى بكثير من اكتشاف ErkM136–144- كانت الخلايا التائية الخاصة من أصل DUC18 (Thy1.1 +) في جميع النقاط الزمنية في فئران TF مقارنة بفئران السل (الشكل 3E) ، مما يشير إلى أن (أ) DUC18 ليس لها عيوب خلوية جوهرية في البقاء على قيد الحياة و (ب) وفاتها هي على الأرجح نتيجة التفاعلات مع الخلايا السرطانية. تم دعم هذه التكهنات الأخيرة من خلال حقيقة أن أكثر من 90 ٪ من خلايا CD8 + T في الورم كانت Thy1.1 + في اليوم الرابع بعد تعزيز VSV (الشكل 3F) ، ولكن بعد ذلك خضعت لموت الخلايا المبرمج التدريجي (من 32 ٪ في اليوم 4) إلى 95٪ في اليوم السادس) بالتزامن مع وقت تراجع الورم. في المقابل ، لم يصل توسع الخلايا التائية الداخلية الخاصة بـ ErkM إلى الذروة حتى 12 ديوبتر (الشكل 3 ب) ، مما يشير إلى أن عددًا كبيرًا من الخلايا التائية الذاتية لم تشارك مباشرة في التفاعلات مع الورم ، وبالتالي استمرت في تجمع الذاكرة.

يتأثر توسع واستمرار خلايا CD8 + T التفاعلية ErkM بالورم أثناء العلاج المركب. (أ) تم جمع الدم الوريدي على dpt المعين. تم تقييم مكون الفيروس من العلاج المركب وتكرار استجابات خلايا CD8 + T الخاصة بـ ErkM. (ب) تم تحديد نسبة الخلايا المنقولة بالتبني مقابل الخلايا الذاتية داخل المجموعة الإجمالية لخلايا CD8 + T الخاصة بـ ErkM في الدورة الدموية بواسطة الأجسام المضادة الخاصة بـ Thy1.1 (المنقولة) و Thy1.2 (الذاتية) في خلايا IFN-γ + المسورة في النقاط الزمنية المشار إليها. (ج) تم تقييم خلايا CD8 + T التي تم جمعها من الدم والطحال ونخاع العظام من الفئران بعد 60 يومًا من انحدار الورم CMS5 الناجم عن العلاج المركب لنوعية ErkM. تمثل النقاط السوداء التردد الكلي لخلايا CD8 + T الخاصة بـ ErkM ، وتمثل الصناديق الرمادية المتراكبة تواتر خلايا CD8 + T الخاصة بـ ErkM. (د) حجم استجابات خلايا CD8 + T الخاصة بـ ErkM و (ه) تواتر Thy1.1 + T الخلايا في المجموعة الإجمالية لخلايا CD8 + T الخاصة بـ ErkM في دوران الفئران السل وفئران TF كما تم تقييمها في النقاط الزمنية المشار إليها. (F) يتم عرض ملفات قياس التدفق الخلوي التمثيلية لخلايا CD8 + T التي تتسلل إلى الورم والتي تم تحديد تكلفتها لـ Thy1.1 و Annexin V في اليومين 4 و 6 بعد التطعيم. البيانات تمثل نتائج 3 (أ و ب) أو 2 (جF) تجارب مستقلة مع ن = 5 لكل مجموعة. تم تحليل البيانات باستخدام ANOVA أحادي الاتجاه (أ) ، 2-الذيل ر اختبار (ج) ، أو مقاييس متكررة ANOVA ثنائية الاتجاه مع تصحيح Holm-idák لمقارنات متعددة (ب, د، و ه). *ص & lt 0.05 ***ص & lt 0.001 ****ص & lt 0.0001.

يؤدي العلاج المركب إلى فقدان المستضد في حالة عدم وجود الخلايا الليمفاوية الذاتية. دفعتنا ملاحظة التوسع الفعال والاستمرار طويل الأمد لخلايا CD8 + T الذاتية المتفاعلة من ErkM في حيوانات CMS5 TB إلى تقييم دور الخلايا الليمفاوية المضيفة في الانحدار الورمي الناتج عن العلاج المركب. كانت الفئران NRG ، التي تفتقر إلى الخلايا الليمفاوية الناضجة ، معروفة. تلقيح 10 6 خلايا CMS5 قبل 6 أيام من العلاج المركب مع 10 6 DUC18 Tcm بالإضافة إلى 10 8 PFU من VSV-ErkM. يوضح الشكل 4 ، A و B ، أن الانحدار الكامل للورم قد تحقق في الفئران NRG ، وعلى الرغم من إطالة فترة البقاء بشكل كبير في المجموعة المعالجة بـ Tcm بالإضافة إلى VSV-ErkM ، فقد انتكست الأورام في جميع الفئران في النهاية. على غرار الملاحظة في الفئران WT ، أصبحت الخلايا التائية المنقولة غير قابلة للكشف في الدورة الدموية بعد انحدار الورم ، ولكن استمر عدد أكبر بكثير من خلايا Thy1.1 + في الفئران TF NRG (الشكل 4C) ، مما يؤكد أن مصير الخلايا التائية المنقولة هو تتأثر بتفاعلاتهم مع الورم. لقد توقعنا أن الخلايا السرطانية CMS5 المنعكسة قد لا تعبر بعد الآن عن حاتمة ErkM وبالتالي نجت من الإزالة بوساطة DUC18. للتحقق من هذا الاحتمال ، أجرينا تجربتين أخريين. أولاً ، أنشأنا أورامًا في الفئران WT BALB / c باستخدام إما CMS5 الأبوية أو خلايا CMS5 المنعكسة المستعادة من الفئران NRG المعالجة بالتركيبة (CMS5r) ، متبوعًا بالعلاج باستخدام DUC18 Tcm بالإضافة إلى VSV-ErkM. يوضح الشكل 4 د أنه تم إعادة تلخيص الانحدار الدائم في الفئران التي تحمل خلايا CMS5 الأبوية ، لكن نفس العلاج فشل في القضاء على خلايا CMS5r ، مما أدى إلى انخفاض كبير في البقاء على قيد الحياة (الشكل 4E) ، مما يؤكد أنه لا يمكن التعرف على خلايا CMS5r بواسطة خلايا CD8 + T الخاصة بـ ErkM . ثانيًا ، أشار تحليل PCR للحمض النووي الجيني من CMS5 و CMS5r و CT26 (خط خلية تحكم غير ذي صلة) إلى أن خلايا CMS5 المنعكسة قد خضعت بالفعل لفقدان تغاير الزيجوت في جين ERK2 ، مما أدى إلى القضاء على أليل ERK2 الطافر وبالتالي فقد من مستضد ErkM (الشكل 4 ، F - H). أخيرًا ، كما هو متوقع ، كانت خلايا CMS5r مقاومة للقتل بواسطة خلايا DUC18 Teff في المختبر بينما جعلها التعبير الهندسي لببتيد ErkM في هذه الخلايا عرضة للقتل ، على غرار خلايا CMS5 ، مما يؤكد أن مقاومة CMS5r لخلية T الخاصة بـ ErkM كان التحلل بسبب عدم وجود تعبير مستضد الهدف ، ولكن ليس بسبب تعديلات أخرى (الشكل التكميلي 3). تسلط هذه النتائج الضوء على دور مهم للخلايا الليمفاوية الذاتية في تجنب الانتقاء المناعي لمتغيرات فقدان المستضد أثناء ACT.

تمنع الخلايا الليمفاوية الذاتية نمو الخلايا السرطانية سلبية المستضد. تم تلقيح الفئران NRG معرف. باستخدام خلايا CMS5 قبل 7 أيام من النقل بالتبني لـ DUC18 Tcm (10 6 خلايا / فأر). بعد يوم واحد من نقل Tcm ، تم تلقيح الفئران IV. مع VSV-ErkM (2 × 10 8 PFU / الماوس). تم تضمين الفئران التي تتلقى VSV-ErkM بمفردها أو Tcm بمفردها أو PBS كعناصر تحكم. (أ) حجم الورم و (ب) يظهر بقاء الفئران المعالجة في dpt المشار إليه. (جتم تحديد عدد خلايا CD8 + T المنقولة (1.1 +) في الدم المحيطي لفئران السل وفئران TF NRG في الأيام 3 و 5 و 12 و 19 بعد العلاج المركب عن طريق تحليل التدفق. تم إعادة تحدي الفئران WT التي نجت من تحدي الورم الأولي CMS5 بعد العلاج باستخدام Tcm بالإضافة إلى VSV-ErkM بخلايا الانتكاس CMS5 (CMS5r) بعد 60 يومًا ، ونمو الورم اللاحق (د) والبقاء (ه) موضحة. تم تضمين الفئران الساذجة التي تلقت CMS5 كعناصر تحكم. يتم عرض البيانات كنتائج تمثيلية لـ 3 (أ و ب) أو 2 (جه) تجارب مستقلة مع ن = 5 لكل مجموعة. تم تحليل البيانات باستخدام مقاييس متكررة ANOVA ثنائية الاتجاه مع تصحيح Holm-idák لمقارنات متعددة (ج) واختبار رتبة السجل (Mantel-Cox) (ب و ه). *ص & lt 0.05 **ص & لتر 0.01. (F) يظهر رسم تخطيطي لمنتج PCR الناتج عن تضخيم الحمض النووي الجيني لجين ERK2 مع Sfcتسلسل التعرف الذي تم إنشاؤه بواسطة طفرة ErkM المعروضة بأحرف كبيرة. تم إنشاء الأجزاء المتوقعة من Sfcيتم عرض هضم أمبليكونات PCR من WT ERK (نطاقات 356bp لـ ErKwt) وأليلات ERK المتحولة (نطاقات 260 و 96 نقطة أساس لـ ErKM) بأقواس منقطة. (جييتم عرض تقييد هضم منتجات PCR المتضخم من CT26 (تحكم سلبي) و CMS5 و CMS5r DNA الجينومي لخط الخلية وكذلك (ح) نتيجة الكروماتوجرام للتسلسل من منتجات PCR.

يلزم وجود كل من خلايا CD4 + و CD8 + T الذاتية لمنع هروب الورم أثناء العلاج المركب. لتحديد المجموعة الفرعية من الخلايا الليمفاوية الداخلية اللازمة لمنع الانتكاس أثناء العلاج المركب ، أجرينا تجارب استنفاد الأجسام المضادة في الجسم الحي في فئران السل المعالجة بـ DUC18 Tcm بالإضافة إلى VSV-ErkM. تم إعطاء الأجسام المضادة ضد CD4 أو Thy1.2 قبل يوم واحد من تلقيح الورم ، بينما تم إعطاء الجسم المضاد لـ CD8 قبل أسبوع واحد لتجنب تأثيره على خلايا DUC18 التائية المنقولة. كان لجميع الفئران المعالجة انحدار الورم بغض النظر عن الاستنفاد الانتقائي للخلايا الليمفاوية الذاتية (الشكل 5 أ) ، وهو مشابه للملاحظات في الفئران المعالجة NRG (الشكل 4 أ) التي تعاني من نقص وراثي في ​​الخلايا الليمفاوية الذاتية. ومع ذلك ، حدث الانتكاس في 80٪ من الفئران التي تلقت الأجسام المضادة لـ CD8 و 100٪ في حالة استنفاد CD4 أو Thy1.2 (الشكل 5 أ) ، مما يؤكد أن كلا من خلايا CD4 + و CD8 + T الذاتية مطلوبة لمنع تكرار الورم بعد العلاج مع لقاح ACT بالإضافة إلى التطعيم المضاد للأورام. قمنا أيضًا بتضمين مجموعة تلقت سيكلوفوسفاميد (CPX) ، وهو دواء كيميائي شائع الاستخدام للنضوب اللمفاوي (26 ، 27) ، قبل يوم واحد من العلاج المركب. على غرار ما حدث مع العلاج بالأجسام المضادة ، لم يؤثر CPX على الانحدار الأولي للورم ، ولكن انتكست جميع الحيوانات في غضون أسبوعين (الشكل 5 أ). أدى استنفاد الأجسام المضادة وعلاجات CPX إلى انخفاض كبير في البقاء على قيد الحياة (الشكل 5 ب)

يلزم وجود كل من خلايا CD4 + و CD8 + T الذاتية لمنع هروب الورم أثناء العلاج المركب. تم استنفاد الفئران CMS5 TB BALB / c من مجموعات الخلايا الليمفاوية المحددة عن طريق العلاج بالأجسام المضادة المشار إليها أو CPX المتزامن مع العلاج مع العلاج المركب ، ونمو الورم الناتج (أ) والبقاء (ب) تم رصدها. تم إعطاء الأجسام المضادة قبل يوم واحد ويوم واحد بعد نقل الخلايا التائية ومرة ​​واحدة في الأسبوع بعد ذلك لمدة 3 أسابيع. تم إعطاء حقنة واحدة من CPX قبل يوم واحد من نقل الخلايا التائية. (جتم قياس تواتر استجابات خلايا CD8 + T التي تنتشر المستضد في الدم المحيطي عن طريق التحفيز بمجموعة من 4 ببتيدات تتوافق مع المناظير الجديدة CMS5 المحددة مسبقًا (27) وتلطيخ لإنتاج IFN-. (د) تم تقييم تواتر الخلايا التائية الخاصة بـ ErkM في الدم المحيطي لفئران BALB / c التي نجت من تحدي ورم CMS5 الأولي بعد العلاج المركب (60 يومًا +) قبل وبعد 5 أيام من إعادة التحدي بخلايا الانتكاس CMS5 أو CM5 (CMS5r) والنتيجة نجاة (ه) يظهر أيضًا. تم تضمين الفئران الساذجة التي تتلقى تحدي CMS5 أو CMS5r كعناصر تحكم. (F) بقاء الفئران المحصنة بخلايا CMS5r المميتة (IrCMS5r) قبل التحدي بخلايا CMS5 أو CMS5r. (جي) إعادة نجاة الفئران المنحدرة من الورم (كما هو موضح أعلاه) مع CMS5r بعد استنفاد مجموعات الخلايا الليمفاوية بالأجسام المضادة المشار إليها. يتم عرض البيانات كممثلة لتجربتين مستقلتين (أه و جي) أو تجربة واحدة (F) مع ن = 5 لكل مجموعة. تم تحليل البيانات باستخدام ANOVA أحادي الاتجاه مع تصحيح Holm-idák لمقارنات متعددة (ج) ، مزدوج الذيل ر اختبار (د) ، واختبار رتبة السجل (Mantel-Cox) (ب و هجي). *ص & lt 0.05 **ص & lt 0.01 ***ص & lt 0.001.

تتمثل إحدى الآليات المحتملة لمتطلبات الخلايا اللمفاوية التائية الذاتية في انتشار الحاتمة ، نتيجة تدمير الورم عن طريق العلاج المركب ، مما يؤدي إلى موجة ثانية من هجوم مضاد للورم ضد مستضدات مختلفة. يبدو أن هذه الفكرة مدعومة بحقيقة أن الانحدار الأولي للورم بعد العلاج المركب لا يتطلب أي خلايا ليمفاوية داخلية (الشكلان 4 أ و 5 أ). وهكذا افترضنا أنه في الجسم الحي استنفاد خلايا CD4 + و / أو CD8 + T في اليوم السادس بعد تلقيح ACT بالإضافة إلى التطعيم الحال للأورام (نقطة زمنية كانت فيها الأورام لا تزال تتراجع) من شأنه أن يؤدي إلى التكرار. ومع ذلك ، من المثير للدهشة أن استنفاد أي من المجموعتين الفرعيتين أو كليهما لم يؤد إلى انتكاس الورم (البيانات غير معروضة) ، مما يشير إلى أن الخلايا التائية الذاتية التفاعل للورم يجب أن تكون موجودة قبل أو يتم تحفيزها بسرعة كبيرة عن طريق العلاج المركب ، وكلاهما ضروري لإكماله. استئصال الخلايا السرطانية بالتعاون مع الخلايا التائية المنقولة بالتبني. الدليل على أن توسع خلايا CD8 + T الذاتية الخاصة بـ ErkM لوحظ في وقت مبكر بعد يومين من تعزيز VSV (الشكل 3 أ) يفضّل إمكانية وجود خلايا T ذاتية المنشأ سابقة التجهيز للورم والتي يمكن إطلاقها أو حتى تعزيزها عن طريق العلاج المركب للمشاركة في وقت مبكر إزالة الورم.

لقد قمنا بمحاولة لتحديد ما إذا كان يمكن اكتشاف استجابات خلايا CD8 + T ضد المستضدات غير المستهدفة في الدورة الدموية. تم جمع الخلايا أحادية النواة من الدم بعد 5 أيام من العلاج باستخدام مادة ACT مع أو بدون تعزيز اللقاح. تم تحديد كمية إنتاج IFN-بواسطة خلايا CD8 + T بعد 4 ساعات من التحفيز باستخدام تجمع الببتيد الذي يتكون من 4 إيبتيدات جديدة مناعية تم تحديدها بواسطة Duan et al. (28). كما هو مبين في الشكل 5C ، على الرغم من أن مستوى استجابات الخلايا التائية CD8 + ضد الببتيدات الجديدة المجمعة كان ضئيلًا في الفئران التي تلقت ACT فقط ، إلا أنه يمكن تعزيزها بشكل كبير عن طريق التطعيم بلقاح حال الورم. أكدت هذه النتيجة ، جنبًا إلى جنب مع البيانات الموضحة في الشكل 2 أ ، أن الخلايا التائية الذاتية المنشأ التي تم تحضيرها للورم والمحددة لكل من المستضدات المستهدفة وغير المستهدفة كانت موجودة ويمكن تضخيمها بسرعة عن طريق التطعيم الحال للأورام.

تشكل الخلايا التائية الداخلية مناعة طويلة الأمد ضد الأورام في الحيوانات بعد العلاج المركب. لتحديد وظيفة المثابرة والحماية للخلايا التائية الذاتية ، خاصة تلك التي تتعرف على مستضدات الأورام غير المستهدفة ، قررنا إعادة تحدي الناجين (TF لمدة 60 يومًا بعد التخلص من أورام CMS5 الأولية) باستخدام معرف. حقن خلايا CMS5r.قمنا أيضًا بتضمين مجموعة تم إعادة تحديها باستخدام خلايا CMS5 الأبوية كعنصر تحكم تحليلي. بعد خمسة أيام من إعادة التحدي ، قمنا بتحفيز عينات PBMCs باستخدام ببتيد ErkM وقارننا تواتر خلايا IFN-γ + CD8 + T بتلك الموجودة في نفس الحيوانات قبل إعادة التحدي. كما هو متوقع ، لوحظت زيادة بمقدار 3 أضعاف تقريبًا في خلايا CD8 + T المتفاعلة من ErkM في الناجين الذين تمت إعادة تحديهم باستخدام CMS5 ، في حين أن إعادة التحدي باستخدام CMS5r لم يعزز أي استجابات لخلايا CD8 + T الخاصة بـ ErkM ، مما يعزز حقيقة أن CMS5r فقد ​​تعبير ErkM (الشكل 5 د). ومن المثير للاهتمام ، مع ذلك ، أنه لا يمكن لأي سطرين من الخلايا تشكيل أورام لدى الناجين ، على الرغم من نمو كلاهما بسرعة في الفئران غير المعالجة وخفض معدل البقاء على قيد الحياة بشكل كبير (الشكل 5E) ، مما يشير إلى أن الذاكرة ضد ErkM وكذلك المستضدات الأخرى استمرت كنتيجة للعلاج المركب الناجح وكان كافياً للتوسط في الحماية ضد إعادة التحدي مع الخلايا الأبوية أو خلايا CMS5 السلبية ErkM. علاوة على ذلك ، كدليل إضافي على المستضدات المشتركة باستثناء ErkM ، تمت حماية الفئران التي تم تحصينها بخلايا CMS5r المشععة بشكل مميت (irrCMS5r) من التحدي اللاحق باستخدام خلايا CMS5 أو CMS5r (الشكل 5F).

لتحديد مجموعة الخلايا الليمفاوية المطلوبة للحماية من CMS5r ، أجرينا استنفادًا بوساطة الجسم المضاد لـ CD8 + أو CD4 + أو كلتا المجموعتين الفرعيتين من الخلايا التائية في الناجين من العلاج المركب قبل إعادة التحدي. أدى استنفاد خلايا CD8 + T إلى نمو الورم في 80 ٪ من الحيوانات التي تواجه تحديات ، بينما طورت جميع الفئران التي تلقت أجسامًا مضادة ضد خلايا CD4 أو كل من CD4 و CD8 T أورامًا ، مما تسبب في انخفاض كبير في البقاء على قيد الحياة في جميع مجموعات النضوب (الشكل 5G). توضح هذه النتائج أن كلا المجموعتين الفرعيتين من الخلايا التائية الذاتية ليست فقط حاسمة لمنع ظهور أو القضاء على متغيرات فقدان المستضد الموجودة مسبقًا أثناء ACT ، ولكن أيضًا لتشكيل مناعة وقائية طويلة الأجل مع خصوصية مستضد واسعة.

إن متطلبات الخلايا اللمفاوية التائية الذاتية للوقاية من انتكاس الورم لا تعتمد على المستضد و / أو النموذج. أخيرًا ، سعينا إلى تقييم النظام الأساسي المركب للتلقيح ACT بالإضافة إلى OV في نموذج ورم مختلف لتحديد دور الخلايا اللمفاوية التائية الذاتية في تحقيق انحدار الورم الكامل والدائم. تحقيقا لهذه الغاية ، اخترنا استخدام VacV كعمود فقري فيروسي حال للأورام لتشفير مستضد جديد بديل gp33 ، الببتيد المناعي من بروتين سكري التهاب السحايا المشيمية اللمفاوي ، وخط خلية سرطان الجلد من الفئران B16 مصمم للتعبير عن gp33 (B16-gp33). C57BL / 6 فئران تحمل معرف تم علاج أورام B16-gp33 باستخدام Tcm المشتق من الخلايا التائية المعدلة وراثيًا P14 TCR الخاصة بـ gp33 متبوعًا بلقاح VacV-gp33. كما هو مبين في الشكل 6 أ ، تم تحقيق انحدار الورم الكامل والدائم في الفئران التي تلقت العلاج المركب ، مما يؤكد فاعلية ومرونة هذه المنصة المركبة لاستهداف مستضدات الورم المختلفة و / أو دمج العمود الفقري OV المختلفة. ومن المثير للاهتمام ، مع ذلك ، أن الفئران التي عولجت إما بجسم مضاد لـ Thy1.2 أو CPX قبل العلاج المركب أظهرت انخفاضًا كبيرًا في معدل البقاء على قيد الحياة بسبب انتكاس الورم بعد الانحدار الأولي (الشكل 6 ، A و B) ، مما يعزز أهمية وجود الخلايا اللمفاوية التائية المضيفة الموجودة مسبقًا والتي من المحتمل توسيع تنوع الهجوم المناعي.

تم إثبات متطلبات الخلايا اللمفاوية التائية الذاتية للوقاية من انتكاس الورم في نموذج مختلف. C57BL / 6 فئران تحمل معرف عمرها 6 أيام. تم إعطاء أورام B16-gp33 ACT (10 6 gp33 محدد Tcm) متبوعًا بالتطعيم بـ 5 × 10 7 PFU VacV-gp33 (كلاهما أعطيت IV). تم إعطاء الأجسام المضادة قبل يوم واحد ويوم واحد بعد نقل الخلايا التائية ومرة ​​واحدة في الأسبوع بعد ذلك لمدة 3 أسابيع. تم إعطاء حقنة واحدة من CPX قبل يوم واحد من ACT. (أ) أحجام الورم و (ب) البقاء على قيد الحياة تم رصده وعرضه. يتم عرض البيانات كنتائج تمثيلية لتجربتين مستقلتين مع ن = 5 لكل مجموعة. تم تحليل البيانات باستخدام اختبار رتبة السجل (Mantel-Cox) (ب). *ص & lt 0.05 **ص & لتر 0.01.

يتم حاليًا تطوير استراتيجيات لتعزيز تفاعل الخلايا التائية بشكل انتقائي ضد المستضدات الجديدة المحددة وراثيًا (29 ، 30). في هذه الدراسة ، اكتشفنا منصة علاجية تجمع بين الخلايا التائية الخاصة بالمستضدات الجديدة (ACT) خارج الجسم الحي مع OVV. تستخدم هذه الإستراتيجية آلية "دفع-سحب" حيث يسهل OVV تنشيط الخلايا التائية وتوسيعها في المحيط (الدفع) ، متبوعًا بتجنيد الخلايا التائية في موقع الورم (سحب). في الواقع ، لقد أظهرنا أن النقل بالتبني لـ Tcm الخاص بمستضد متبوعًا بلقاح حال للأورام أدى إلى توسع قوي للخلايا التائية ، وتسلل الورم ، وانحدار الورم الكامل ، مما يكشف عن تآزر قوي بين هذين النهجين العلاجيين. الأهم من ذلك ، أن الفعالية تحققت في غياب الشروط المسبقة (أي ، تشعيع الجسم بالكامل أو العلاج الكيميائي المستنفد لللمفاوي قبل نقل الخلية) ومساعدات IL-2 ، 2 الخارجية التي يتم استخدامها عادةً في إعدادات ACT الأخرى (15 ، 16) ، تسليط الضوء الآثار المترجمة للعلاج المركب لدينا والتي قد تقدم تجربة أقل كثافة للمريض. علاوة على ذلك ، والأهم من ذلك ، فإن تجاوز الشروط المسبقة يحافظ على الخلايا التائية الذاتية التهيئة للورم والتي لا تكمل فقط ACT للقضاء على الورم الأولي ومنع ظهور متغيرات فقدان المستضد ، ولكن أيضًا تشكل مجموعة ذاكرة طويلة المدى للمراقبة المناعية.

على الرغم من النجاح في علاج الأورام الخبيثة للخلايا البائية والورم الميلانيني ، فإن تأثيرات ACT لها تأثيرات محدودة فقط على معظم الأورام الصلبة (31 ، 32). تشمل العقبات ، من بين جوانب أخرى ، عدم كفاءة الخلايا التائية المنقولة في تسلل الورم بكميات كافية واستمرارها لفترة كافية لقتل جميع الخلايا الخبيثة (33 ، 34). قد تؤدي زيادة جرعة الخلايا المنقولة إلى تحسين قدرتها على الوصول إلى الأورام الصلبة وقتلها ، ولكن إنتاج عدد كبير من الخلايا التائية خارج الجسم الحي يتطلب توسعًا واسعًا يؤدي حتمًا إلى التمايز النهائي والشيخوخة التكرارية للخلايا التائية (35 ، 36). علاوة على ذلك ، غالبًا ما تجعل البيئة المكروية شديدة القمع والمناظر الطبيعية للمستضد غير المتجانسة المرتبطة بالأورام الصلبة الخلايا التائية غير فعالة وتعزز هروب المستضد (37 ، 38). وبالتالي ، لتحقيق الانحدار المستمر للأورام الصلبة ، يجب دمج ACT مع الأساليب الأخرى التي يمكن أن تحفز في الوقت نفسه تمدد الخلايا التائية ، وتجنيد الخلايا التائية في الورم ، والتغلب على كبت المناعة بوساطة الورم ، وتوسيع نطاق خصوصية الخلايا التائية. لقد أظهرنا سابقًا أن لقاحات الأورام يمكن أن توسع بشكل فعال Tcm الخاص بالورم مع الاحتفاظ بخصائصها المفيدة في حالة الأورام ، مما دفعنا إلى افتراض أن OVVs قد تمثل منصة مثالية للجمع مع ACT بسبب التطعيم ووظائف حل الأورام (18 ، 19). في الواقع ، نحن نقدم دليلًا في هذه الدراسة على أنه لا OV (لا يوجد مستضد للورم) ولا اللقاح التقليدي (غير مسبب للحل) كان كافيين للتآزر مع ACT وأن تدمير الأورام الصلبة المستقرة يتطلب تضخيمًا وتسلل الورم للخلايا التائية المنقولة. تحقيقا لهذه الغاية ، كانت Tcm متفوقة على Teff نظرًا لفعاليتها وقدرتها على التكاثر ، بما يتوافق مع مفهوم يحظى بتقدير متزايد في مجال ACT (35 ، 36).

لقد قدمنا ​​ملاحظتين إضافيتين قد يكون لها آثار مهمة في الممارسة السريرية الحالية والتصميم العقلاني لـ ACT. أولاً ، على الرغم من أن تراجع الورم قد تحقق في الفئران التي تعاني من نقص المناعة بعد تلقيح ACT بالإضافة إلى لقاح OV ، عادت الأورام للظهور في غضون أسبوعين. كان من الواضح أن الخلايا السرطانية المنعكسة لم تعد تؤوي الهدف الحاتمي للخلايا التائية المنقولة. يبدو أن هذه النتيجة تدعم الفكرة القائلة بأن استهداف الأورام بمجموعة من الخلايا التائية الخاصة بمجموعة محدودة من المستضدات قد يؤدي إلى نمو انتقائي لمتغيرات الورم السالبة للمستضد. ومع ذلك ، تم تحقيق الانحدار الدائم بشكل ثابت في حيوانات WT ، مما يشير إلى أنه يمكن معالجة عدم تجانس الورم و / أو الهروب المناعي عن طريق تعبئة الخلايا التائية الذاتية خلال ACT ، حتى استهداف مستضد واحد. ملاحظتنا أن استنفاد خلايا CD4 + أو CD8 + T قبل علاج ACT بالإضافة إلى OV لم يؤثر على الانحدار الأولي للورم ، ولكنه أدى إلى الانتكاس ، مما يشير إلى وجود تعاون بين الخلايا التائية المنقولة والخلايا التائية الذاتية. يبدو أن الخلايا التائية المنقولة تلعب دورًا أساسيًا في التوسط في إزالة الورم (استئصال ErkM + الخلايا السرطانية) ، بينما تكون الخلايا التائية الذاتية مطلوبة للتخلص من المتغيرات الهاربة (ErkM - الخلايا السرطانية). إحدى الآليات المحتملة التي تفسر تنشيط الخلايا التائية الذاتية هي انتشار الحاتمة ، وهي ظاهرة تنطوي على التمثيل المتبادل في الجسم الحي للمستضدات المشتقة من الورم والتي يتم إطلاقها في موجة واحدة من الهجوم المناعي لتعزيز الجولات اللاحقة من الخلايا التائية المضادة للورم ضد مستضدات مختلفة (14 ، 39). قد تكون هذه الأحداث المتسلسلة فعالة بشكل خاص في حالتنا بسبب تحلل الورم القوي والالتهاب بوساطة الخلايا التائية والـ OVs المنقولة. ومع ذلك ، هناك آلية أخرى معقولة وهي أن الخلايا التائية الموجودة مسبقًا يتم إطلاقها و / أو توسيعها بواسطة علاج ACT بالإضافة إلى OV ، مما يوفر ذخيرة أوسع لاستكمال الخلايا التائية المنقولة من أجل القضاء التام على جميع الخلايا السرطانية. هذا الاحتمال الأخير مدعوم بعدة أسطر من الأدلة. أولاً ، يمكن اكتشاف وجود خلايا CD8 + T الخاصة بـ ErkM وتعزيزها في أقرب وقت ممكن بعد يومين من ACT بالإضافة إلى OVV. ثانيًا ، تجلت أيضًا استجابات الخلايا التائية المتزايدة على المناظير الجديدة غير المستهدفة بعد 5 أيام من العلاج المركب. من غير المحتمل أن تكون هذه الملاحظات نتيجة انتشار الحاتمة التي تتطلب تنشيط الخلايا التائية الساذجة. علاوة على ذلك ، فإن حقيقة أن استنفاد خلايا CD4 + أو CD8 + T بعد 6 أيام من العلاج لم يؤدي إلى الانتكاس تشير إلى أن الخلايا التائية الموجودة مسبقًا ، ولكن لم يتم تحفيزها لاحقًا ، تشارك في التخلص المبكر من الخلايا السرطانية بالتعاون مع الخلايا التائية المنقولة. ومع ذلك ، فمن المحتمل أن يقوم ACT بالإضافة إلى OV بإعادة تنشيط الخلايا التائية الخاصة بالمستضد الموجودة مسبقًا والحث على استجابات الخلايا التائية الجديدة عبر حاتمة تنتشر بطريقة متسلسلة تعكس أهميتها النسبية أثناء توليد مناعة مضادة للورم (39 ، 40). هناك حاجة إلى مزيد من العمل في كلا السيناريوهين لتحديد ما إذا كانت تلك المستضدات غير المحددة التي تم التعرف عليها من خلال الخلايا التائية النامية بشكل طبيعي أو المستحثة علاجيًا مشتقة من طفرات خاصة بالورم أو مستضدات ذاتية.

ثانيًا ، يعتبر استمرار الخلايا التائية المنقولة على المدى الطويل أمرًا مهمًا ، وقد تم الإبلاغ عن وجود علاقة إيجابية بين انحدار الورم ودرجة استمرار استنساخ الخلايا التائية المنقولة بالتبني (41 ، 42). ومن المثير للاهتمام ، مع ذلك ، أن الخلايا التائية المضادة لـ ErkM CD8 + T المنقولة اختفت مباشرة بعد تراجع الورم ، بينما نجت خلايا CD8 + T الذاتية الخاصة بـ ErkM لفترة طويلة وكانت قادرة على توفير مناعة واقية خاصة بالمستضد. نتوقع أن الملاحظة في دراستنا ترجع إلى إدخال التطعيم الحال للأورام الذي لا يسرع فقط استجابات الخلايا التائية المنقولة ويكثف تفاعلها مع الأورام ، ولكنه يشرك أيضًا استجابات الخلايا التائية المضادة للورم الذاتية. في الواقع ، أظهرنا أن الخلايا التائية المنقولة سيطرت على التوسع المبكر وتسلل الورم وكانت مسؤولة عن التوسط في الانحدار الأولي للورم. نتيجة لذلك ، خضعت الخلايا التائية المنقولة لموت الخلايا المبرمج الناجم عن الورم ، وهي ظاهرة موثقة في الدراسات السابقة (43 ، 44). في المقابل ، لم يصل توسع الخلايا التائية الذاتية إلى ذروته إلا بعد عدة أيام من تراجع الورم ، مما يشير إلى أن غالبية الخلايا التائية الداخلية المنشأ المعززة و / أو المستحثة علاجيًا لم تختبر تفاعلات مع الخلايا السرطانية ، وبالتالي نجت من أجل الحفاظ على مناعة ضد الورم. تؤكد حقيقة أن الخلايا التائية المنقولة في فئران TF نجت على المدى الطويل أن المصير قصير العمر للخلايا التائية المنقولة في فئران السل هو على الأرجح نتيجة تفاعلها مع الخلايا السرطانية. تجادل نتائجنا بأن الحفاظ على الخلايا التائية الداخلية للورم المتفاعلة خلال ACT أمر حيوي لضمان القضاء على المرض والذاكرة المضادة للورم طويلة المدى ، والتي قد تتعرض للخطر عن طريق التكييف المسبق في محاولة لزيادة بقاء الخلايا المنقولة بالتبني (16).

بشكل جماعي ، تدعم بياناتنا إمكانية تسخير ذخيرة الخلايا التائية من خلال إشراك الخلايا اللمفاوية التائية المضيفة للورم أثناء إجراء ACT وبالتالي تقليل أو حتى القضاء على مخاطر النمو السلبي للمستضد الذي ينتج عن إدخال ضغط انتقائي فردي. حقيقة أن العديد من المرضى لديهم خلايا CD4 + و / أو CD8 + T التي تتعرف على المناظير الجديدة المختلفة المشتقة من أورام المرضى نفسها تؤكد أهمية النتائج التي توصلنا إليها (45 ، 46). على الرغم من أنه لا يزال يتعين رؤية مدى جودة ترجمة نتائجنا من نماذج الفئران إلى العيادة ، إلا أن هناك أدلة متزايدة على أهمية انتشار المستضد المستحث بالـ OV وتطوير استجابات الخلايا التائية الذاتية بالتوازي مع ACT في العيادة (47 ، 48). علاوة على ذلك ، تم تطوير منهجيات سريرية لتوليد Tcm الخاص بالورم من مرضى السرطان ، جنبًا إلى جنب مع ملفات تعريف السلامة المؤكدة لمختلف OVs ، مما يدعم فكرة أن العلاج المركب لدينا قابل للترجمة سريريًا بدرجة عالية (7-9 ، 49 ، 50).

الحيوانات. تم شراء الفئران BALB / c أو C57BL / 6 من معامل Charles River Laboratories وتم وضعها في غرفة محددة خالية من مسببات الأمراض في مرفق الحيوانات المركزية بجامعة McMaster. NRG (NOD.Cg-راج 1 tm1Mom Il2rg تم شراء مربي tm1Wjl / SzJ) من مختبر جاكسون ، وتم تربية الفئران في ظروف فائقة النقاء. تم توفير الفئران DUC18 من قبل ليس نوريان (جامعة أيوا ، أيوا سيتي ، أيوا ، الولايات المتحدة الأمريكية) (22). تم شراء الفئران B6.Cg-Tcratm1Mom Tg (TcrLCMV) 327Sdz (P14) من مختبرات Taconic Breeding.

النواقل الفيروسية. تم تصميم المؤتلف VSV للتعبير عن حاتمة مقيد H-2K d تتوافق مع الأحماض الأمينية 136-144 من بروتين ERK2 المتحول (ErkM136–144) ، وأطلق على ناقل لقاح VSV الناتج اسم VSV-ErkM. VSV-MT هو ناقل تحكم يفتقر إلى الجينات المحورة. Ad-ErkM هو ناقل غدي ناقص النسخ المتماثل ، محذوف من E1 / E3 يحتوي على حاتمة ErkM. VacV-gp33 عبارة عن VacV مؤتلف محذوف من TK (سلالة Western Reserve) معربًا عن gp33 ، حاتمة مقيد H-2D b مشتقة من بروتين سكري لفيروس التهاب السحايا الليمفاوية (51).

الببتيدات. تم شراء الببتيدات لـ ErkM (QYIHSANVL) ، و gp33 (KAVYNFATM) ، و Alkbh6.2 (DVPMEQPR) ، و Slit3 (GFHGCIHEVI) ، و Atxn10.1 (QVFPGLMEI) ، و Ccdc136 (ELQGLLEDEI) المذابة في Biomer Technologies. .

تحدي خطوط الخلايا والورم. تم الحفاظ على جميع الخلايا عند 37 درجة مئوية في جو رطب بنسبة 5 ٪ من ثاني أكسيد الكربون2. تمت زراعة خلايا CMS5 (هدية من Lyse Norian) (22) و CMS5r و CMS5r-LVErkM في DMEM مع 10 ٪ FBS والبنسلين / الستربتومايسين (100 وحدة / مل و 100 نانوغرام / مل ، على التوالي) ، و 2 ملي مول لتر. - الجلوتامين (Thermo Fisher Scientific). تم الحفاظ على خلايا B16-gp33 (خلايا B16F10 منقولة بشكل ثابت باستخدام minigene يتوافق مع الببتيد gp33) (52) في MEM / F11 التي تحتوي على 10 ٪ FBS ، 2 ملي غلوتامين ، 5 مل بيروفات الصوديوم ، 5 مل من الأحماض الأمينية غير الأساسية ، 5 محلول فيتامين مل (Thermo Fisher Scientific) ، 55 ميكرومتر 2-مركابتوإيثانول (Sigma-Aldrich) ، 100 وحدة / مل بنسلين ، و 100 نانوغرام / مل ستربتومايسين.

تم غسل الخلايا السرطانية مرتين باستخدام برنامج تلفزيوني وتم تعليقها في برنامج تلفزيوني بتركيز 10 6 خلايا / 30 ميكرولتر لخلايا CMS5 أو 10 5 خلايا / 30 ميكرولتر لخلايا B16-gp33. تم تحدي الفئران عبر معرف. الحقن ، وتم السماح للأورام بالنمو إلى حجم متوسط ​​يقارب 150 مم 3 قبل بدء العلاج. تم الحصول على خلايا CMS5 المنعكسة (تسمى CMS5r) من الفئران NRG نقطة النهاية. تم إنشاء CMS5r-LVErkM عن طريق تحويل CMS5r باستخدام فيروس لينتيفيروس مصمم للتعبير عن الببتيد ErkM عن طريق صلب الاشعال 5 ′ الفسفرة (ErkM ، إلى الأمام ، GATCCATGCAATACATACACTCAGCTAACGTGTTGTAAG ErkM ، reverse ، AATTGTGTG) بامهانا و ايكوأنا مواقع pLV-EF1a-IRES-Puro (بلازميد 8513 من Addgene المرجع 53). بعد التحويل ، تم إنشاء خط خلية متعددة النسيلة باستخدام اختيار بوروميسين (Invitrogen).

لتجارب التطعيم ضد الإشعاع المميت ، تم تجريب خلايا CMS5r ، وتعليقها في PBS عند 3 × 10 7 خلايا / مل ، وتعريضها لـ 150 Gy باستخدام Gammacell 1000 (Best Theratronics Ltd.) مع مصدر Cs-137 قبل معرف. حقن ما يقرب من 10 6 خلايا لكل فأر. تم تحصين الفئران مرتين كل أسبوع وتم تحدى الفئران بـ 2 × 10 5 خلايا حية بعد أسبوع واحد من التطعيم الثاني.

تحليل PCR. تم استخراج الحمض النووي الجينومي من خلايا CMS5 و CMS5r و CT26 باستخدام مجموعات استخراج الحمض النووي الجينومي من Purelink (تقنيات الحياة) وفقًا لتعليمات الشركة المصنعة. تم إجراء PCR على الحمض النووي المستخرج باستخدام بادئات ERK2 (ERK2 ، للأمام ، 5′-TGTGCCGTGTTCTCTTCAGT-3 ′ ، ERK2 ، عكس ، 5′-TGACTTGGCTGACCTTGAGA-3) مع مجموعة Q5 عالية الدقة DNA Polymerase Kit (New England Biolabs) تعليمات الشركة المصنعة ، على T3000 Thermocycler (Biometra). كان برنامج التضخيم كالتالي: 98 درجة مئوية لمدة 30 ثانية ، ثم 98 درجة مئوية لمدة 10 ثوان ، و 58 درجة مئوية لمدة 30 ثانية ، و 72 درجة مئوية لمدة 30 ثانية (× 35 دورة) ، مع استطالة نهائية عند 72 درجة مئوية لمدة 2 الدقائق. تم هضم منتجات التضخيم باستخدام Sfc1 وتشغيلها على هلام agarose Ultra Pure 1٪ (تقنيات الحياة) مع صبغة / عازلة تحميل EZ-Vision (Amresco). تم تسلسل منتج PCR من كل خط خلية باستخدام التمهيدي الموصوف أعلاه.

تمايز الخلايا التائية في المختبر. تم عزل الخلايا الطحالية السائبة من الفئران المعدلة وراثيا وتربيتها لمدة 7 أيام في وجود 100 نانوغرام / مل من ErkM أو gp33 الببتيد. من أجل تمايز Tcm ، تمت إضافة 10 نانوغرام / مل IL-15 ، و 10 نانوغرام / مل IL-21 (BioLegend) ، و 20 نانوغرام / مل رابامايسين (Sigma-Aldrich) إلى الثقافة ، بينما 60 وحدة / مل IL-2 (BioLegend) ) لإنتاج مادة Teff.

الجمع بين العلاج. عندما وصلت الأورام إلى حجم متوسط ​​تقريبي يبلغ 150 مم 3 ، تم حقن الخلايا التائية المعدلة وراثيًا CD8 + المتباينة في المختبر في الوريد. في الفئران السل بجرعة 10 6 خلايا / 200 ميكرولتر من برنامج تلفزيوني. بعد 24 ساعة ، تم علاج الفئران بلقاحات مختلفة. تم تسليم ناقلات VSV (2 × 10 8 PFU) واللقس (7 × 10 7 PFU) في الوريد. و Ad-ErkM (5 × 10 8 PFU) في العضل. يتكون لقاح الببتيد من 150 ميكروغرام من ببتيد Erk الاصطناعي ، و 100 ميكروغرام من مضاد CD40 Ab (استنساخ FGK4.5 / FGK45 ، و Bio X Cell) ، و 50 ميكروغرام poly-IC (Sigma-Aldrich) ، تدار على شكل خليط عبر الرابع. المسار كما تم تحسينه مسبقًا بواسطة Cho et al. (25).

تلطيخ الخلايا السطحية وداخل الخلايا. تم شراء البقع التالية و Abs لتحليل التدفق الخلوي من BD Biosciences: Fc block (كتالوج 553141) ، 7AAD (كتالوج 559925) ، Fixable Viability Stain 510 (كتالوج 564406) ، Pacific Blue rat anti-mouse CD8a (استنساخ 558106) ، APC الفئران المضادة للفأر IFN-γ (استنساخ XMG1.2) ، PE الفئران المضادة للفأر CD4 (استنساخ GK1.5) ، PE الماوس المضادة للفأر Thy1.1 (استنساخ OX-7) ، Alexa Fluor 700 الفئران المضادة للفأر CD62L (استنساخ MEL-14) ، و FITC الفئران المضادة للفأر CD44 (استنساخ IM-7). تم جمع عينات الدم والطحال ونخاع العظام وعلاجها باستخدام محلول ACK لإزالة خلايا الدم الحمراء قبل تحفيز الببتيد و / أو تلطيخه. تمت معالجة الخلايا باستخدام Fc Block وملطخة بعلامات السطح متبوعة بتلطيخ الصلاحية.لتحليل الاستجابات الخاصة بالمستضد ، تم استخراج PBMCs من عينات الدم باستخدام محلول تحلل RBC وتحفيزها باستخدام ErkM أو gp33 الببتيد (1 ميكروغرام / مل) في الثقافة عند 37 درجة مئوية لمدة 4 ساعات. تمت إضافة Brefeldin A (GolgiPlug ، BD Biosciences 1 ميكروغرام / مل) لآخر 3 ساعات من الحضانة. تم إجراء الحجب وتلطيخ السطح على النحو الوارد أعلاه باستثناء أن الخلايا كانت ملطخة بصبغة قابلة للتثبيت قبل التثبيت / النفاذية (Cytofix / Cytoperm ، BD Biosciences) وتم اكتشاف مضان التلوين داخل الخلايا باستخدام مقياس التدفق الخلوي BD LSRFortessa أو LSR II (BD Biosciences) . تم تحليل البيانات باستخدام برنامج تحليل التدفق الخلوي FlowJo (الإصدار 10) (Tree Star).

فحص السمية الخلوية تم تصنيف خلايا CMS5r-LVErlM بـ 5 ميكرومتر من CFSE (MilliporeSigma ، كتالوج 21888) ، مصنفة في صفيحة 96 بئر عند 10 5 خلايا لكل بئر ، وزرعت مع DUC18 Teffs (تم إنشاؤه على النحو الوارد أعلاه) بالنسب المشار إليها لمدة 16 ساعة. كانت الخلايا ملطخة بـ eBioscience Fixable Viability Dye eFluor 780 (كتالوج 65-0865-14 ، Thermo Fisher) ، وتم تقييم التلوين عن طريق قياس التدفق الخلوي على النحو الوارد أعلاه. ثم تم حساب النسبة المئوية للتحلل المحدد باستخدام المعادلة التالية: النسبة المئوية للتحلل النوعي = 100 × (٪ موت الخلية المحدد -٪ موت الخلايا القاعدية) / 100 -٪ موت الخلايا القاعدية ، حيث يتم تحديد موت الخلية المحدد من تلطيخ الصبغة الحيوية لـ CFSE - الخلايا الإيجابية في الآبار المزروعة بالخلايا التائية وموت الخلايا القاعدية من الآبار التي تفتقر إلى الخلايا التائية المزروعة

نضوب الخلايا اللمفاوية التائية في الجسم الحي. تم تحقيق نضوب الخلايا التائية بمقدار 2 لتر. حقن CD4 و CD8 المضاد للفأر (ينتج من الورم الهجين GK1.5 و 2.43 ، على التوالي ، المشتراة من ATCC) أو الجسم المضاد Thy1.2 (استنساخ 30H12 ، Bio X Cell) بجرعة 250 ميكروغرام / 200 ميكرولتر متباعدة 48 ساعة . اتبعت المعالجة بالأجسام المضادة للتحكم في النمط المتماثل (استنساخ HRPN ، و Bio X Cell) نفس النمط. للملاحظات الأطول ، تم الحفاظ على النضوب باستخدام i.p. حقن الأجسام المضادة المقابلة. كان CPX (Sigma-Aldrich) i.p. تدار قبل يوم واحد من نقل الخلايا التائية بجرعة 3 ملغ / فأر. تمت مراقبة كفاءة النضوب عن طريق تحليل نظام مراقبة الأصول الميدانية لـ PBMCs في نقاط زمنية مختلفة أثناء العلاج (لا تظهر البيانات).

علم الانسجة. تم إجراء الكيمياء الهيستولوجية المناعية على أقسام من أنسجة الورم المثبتة بالفورمالين والمضمنة بالبارافين باستخدام صبغة Leica Bond Rx الآلية (Leica Biosystem). تم إزالة الشمع من الشرائح ومعالجتها مسبقًا باستخدام المخزن المؤقت Leica Bond Epitope Retrieval # 2 (Leica Biosystems) لمدة 20 دقيقة قبل تلطيخها بجسم مضاد CD8α مضاد للفئران (مخفف 1: 1000 استنساخ 4SM15 ، Thermo Fisher Scientific). تم تطوير اللون باستخدام مجموعة Leica Bond Polymer Refine Detection Kit (Leica Biosystems) ، لتحل محل مكون ما بعد الابتدائية بجسم مضاد للفئران (1: 100 ، Vector Laboratories). تم التقاط الصور باستخدام مجهر Axiovert 100M (Zeiss) ، وتم إجراء القياس الكمي باستخدام وظيفة تحليل الجسيمات في برنامج ImageJ (54).

إحصائيات. تم استخدام GraphPad Prism for Windows للرسم البياني والتحليلات الإحصائية. تم الاستعلام عن الاختلافات بين وسائل بيانات الاستجابة المناعية باستخدام ثنائي الطرف للطالب ر اختبار ، ANOVA أحادي الاتجاه ، أو مقاييس متكررة ANOVA ثنائية الاتجاه كما هو موضح في أساطير الشكل. عند الضرورة ، تم استخدام طريقة Holm-idák لتصحيح المقارنات المتعددة. بشكل عام ، أ ص اعتبرت قيمة أقل من 0.05 ذات دلالة إحصائية. يتم عرض أشرطة متوسط ​​+ SD. تم إنشاء منحنيات البقاء باستخدام طريقة Kaplan-Meier ، بحجم الورم 1000 مم 2 أو تقرح الورم كنقطة نهاية ، وتم تحليلها باستخدام اختبار رتبة السجل (Mantel-Cox).

الموافقة على الدراسة. كانت جميع التجارب على الحيوانات متوافقة مع إرشادات المجلس الكندي لرعاية الحيوان وحصلت على موافقة داخلية من خلال مجلس أخلاقيات أبحاث الحيوان بجامعة ماكماستر.

أجرى كل من SRW و BS و LC و DB و AN و TSM التجارب ، وقاموا بتحليل البيانات ، وساعدوا في إعداد المخطوطات. قام KS و BDL ببناء النواقل الفيروسية وساعدا في تحليل البيانات. أشرف JLB و SRW و YW على التصميم التجريبي وتفسير البيانات وأعدوا المخطوطة.

نشكر ليس نوريان لتوفير الفئران DUC18. أجريت هذه الدراسة بدعم من معهد أونتاريو لأبحاث السرطان من خلال التمويل المقدم من حكومة أونتاريو ، وكذلك المعاهد الكندية للأبحاث الصحية (FRN 123516 و FRN 152954) ، وجمعية السرطان الكندية (منحة 705143) ، و معهد تيري فوكس للأبحاث (TFRI-1073).

تضارب المصالح: SRW و BS و LC و YW هم مخترعون في طلب براءة رقم. CA2017 / 050772 (رقم المنشور WO / 2017/219150) ، مقدم من جامعة ماك ماستر ، والذي يغطي استخدام العلاج بالخلايا التائية بالتبني والعلاج المركب للتلقيح ضد فيروس الورم.


شاهد الفيديو: هل الماوس والكيبورد صعبة. كيف تتعلم بأسرع وقت (يوليو 2022).


تعليقات:

  1. Katlyne

    حق تماما! ومن المستحسن. وهي على استعداد لدعمكم.

  2. Dorn

    إنها الفضيحة!

  3. Culver

    إنه لأمر مؤسف أنني لا أستطيع التحدث الآن - لقد تأخرت عن الاجتماع. سأعود - سأعرب بالتأكيد عن رأيي في هذه المسألة.

  4. Moketavato

    ما هو الوقاحة!

  5. Dimuro

    تم محوه (به قسم مرتبك)



اكتب رسالة